Overview

Comprehensive Description

The Sargassum Fish (Histrio histrio) is a member of the frogfish family (Antennariidae), a group of small, globular fishes with stalked, grasping, limb-like pectoral fins with small gill openings behind the base, a trapdoor-like mouth high on the head, and a "fishing lure" (formed by the first dorsal spine) on the snout. The Sargassum Fish occurs worldwide in tropical and warm-temperate waters. It typically lives in open waters in close association with floating Sargassum Weed (Sargassum natans and S. fluitans), but is frequently blown into nearshore and bay waters during storms. (Boschung et al. 1983; Robins and Ray 1986) Although the Sargassum Fish is capable of swimming quite rapidly, it often crawls through the Sargassum Weed, using its pectoral fins like arms (Rothschild 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Found near the surface, usually associated with floating objects (Ref. 26340) or Sargassum. Commonly blown into shore and bay waters during storms (Ref. 7251). Epipelagic (Ref. 58302). A solitary (Ref. 26340) and voracious predator (Ref. 5521). They feed on fishes and shrimps that seek refuge in the floating weeds (Ref. 48635). Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773, 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Chagos, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Reunion, Seychelles, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: tip of South Africa eastward to Indian and Sri Lanka, including the Red Sea, Madagascar, Réunion and Mauritius. Western Pacific: Hokkaido to tropical Australia (as far south as Perth in the west and Sydney in the east), including Taiwan, Philippines, Moluccas, southern Papua New Guinea, Guam, Tonga, New Caledonia and New Zealand; Mariana Islands in Micronesia (Ref. 1602). Occurrence in the eastern Pacific remains problematic. Northwest Atlantic: Canada (Ref. 5951). Western Atlantic: Gulf of Maine to the mouth of the Rio de la Plata, Uruguay. Eastern Atlantic: Azores and off West Africa; record from Vardø, northern Norway (Düben & Koren 1846) is based on a straggler taken northward by the North Atlantic and Norwegian currents.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Scotian Shelf, Gulf of Maine, and Gulf Stream to the mouth of the Rio de la Plata, Uruguay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Sargassum Fish (Histrio histrio) occurs worldwide in tropical and warm-temperate waters. In the western Atlantic, it is found from Massachusetts, Bermuda, and the northern Gulf of Mexico and West Indies to southeastern Brazil. (Boschung et al. 1983; Robins and Ray 1986) A small number of specimens have been collected on several occasions off the Kona coast of Hawaii. The discovery of two small juveniles (both about 10 mm SL) here indicates that these specimens are the products of a breeding population rather than migrants from the west. (Pietsch et al. 1992).

The Sargassum Fish has the broadest longitudinal and latitudinal range of any frogfish. Its distribution largely coincides with that of floating Sargassum Weed, with which it is apparently an obligate associate. In the western Atlantic, this species extends from the Gulf of Maine to the mouth of the Rio de la Plata, Uruguay. On the eastern side of the Atlantic, it is apparently quite rare; Pietsch and Grobecker (1987) reported specimens only from the Azores and off West Africa. An old record from Vardo, northern Norway, is likely based on a straggler carried northward by the North Atlantic and Norwegian currents. In the Indian Ocean, the Sargassum Fish is known from the tip of South Africa eastward to India and Sri Lanka, with verified records from the Red Sea, Madagascar, Reunion, and Mauritius. In the western Pacific and on the western margin of the Pacific plate, it occurs from Hokkaido, Japan, to tropical Australia (about as far south as Perth in the west and Sydney in the east), including Taiwan, the Philippines and Moluccas, and the southern coast of Papua New Guinea. There are rare but verified records from Guam, Tonga, New Caledonia, and the North Island of New Zealand. (Pietsch and Grobecker 1987; Pietsch et al. 1992 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Red Sea, Seychelles, Madagascar, Mascarenes, Hawaiian Islands, Galapagos Archipelago), but except most of Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical and subtropical, sometimes drifts far northward with the Gulf Stream.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Pietsch, T. W. and D. B. Grobecker, 1987; B?e, J. E. and C. C. G. Chaplin, 1993; Claro, R., 1994; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 11 - 13; Analspines: 0; Analsoft rays: 7 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Sargassum Fish is unscaled and (unusually for a frogfish) as a consequence has skin that is smooth rather than sandpapery. Its color is variable and changeable, depending on the amount of light and the mood of the fish. It is typically boldly patterned with mahogany brown on a yellowish to olive background, its mottled pattern helping it blend in with the Sargassum Weed in which it lives, but it may be almost black or predominantly yellow with dark spots and blotches. It has many fleshy tabs, the largest on the chin and belly. Its "lure" is a fleshy bulb with filaments attached to a short "pole". The lure is formed by the first dorsal spine; the second and third dorsal spines are large, depressible, and covered with skin bearing fleshy cirri (fingerlike protuberances). (Robins and Ray 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Sargassum Fish may reach a length of 20 cm, but rarely exceeds about half this size (Robins and Ray 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 20 cm TL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Pietsch, T. W. and D. B. Grobecker, 1987; B?e, J. E. and C. C. G. Chaplin, 1993; Claro, R., 1994; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color mottled green with numerous fleshy weed-like dermal appendages (Ref. 1602) blending with the floating Sargassum weed in which it is usually found. Illicium much shorter than 2nd dorsal spine. Esca globular with short filaments. Skin smooth, without dermal spinules; pectoral stalk free from body for most of its length (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Clings to floating @Sargassum@, commonly blown into shore and bay waters during storms (Ref. 7251). A voracious predator (Ref. 5521).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Histrio histrio
Catalog Number: USNM 37434
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Type: Poey, F. 1881. Anales de la Sociedad Espanola de Historia Natural Madrid. 10: 340, pl. 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 0 - 50 m (Ref. 58302), usually 0 - 2 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found to depths of 11 m, often near surface with floating objects like Sargassum.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 396 specimens in 1 taxon.
Water temperature and chemistry ranges based on 345 samples.

Environmental ranges
  Depth range (m): 0 - 4572
  Temperature range (°C): 2.258 - 28.409
  Nitrate (umol/L): 0.176 - 28.453
  Salinity (PPS): 32.493 - 36.622
  Oxygen (ml/l): 2.895 - 6.053
  Phosphate (umol/l): 0.034 - 1.751
  Silicate (umol/l): 0.769 - 34.597

Graphical representation

Depth range (m): 0 - 4572

Temperature range (°C): 2.258 - 28.409

Nitrate (umol/L): 0.176 - 28.453

Salinity (PPS): 32.493 - 36.622

Oxygen (ml/l): 2.895 - 6.053

Phosphate (umol/l): 0.034 - 1.751

Silicate (umol/l): 0.769 - 34.597
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 11m.
Recorded at 11 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine; depth to 11 m. Found near the surface, usually associated with floating objects or Sargassum weed, and can be blown into shore and bay waters during storms. Solitary.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Pietsch, T. W. and D. B. Grobecker, 1987; B?e, J. E. and C. C. G. Chaplin, 1993; Claro, R., 1994; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found near the surface, usually associated with floating objects (Ref. 26340) or Sargassum. Commonly blown into shore and bay waters during storms (Ref. 7251). Epipelagic (Ref. 58302). A solitary (Ref. 26340) and voracious predator (Ref. 5521). Feeds on fishes and shrimps that seek refuge in the floating weeds (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

predatory.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Pietsch, T. W. and D. B. Grobecker, 1987; B?e, J. E. and C. C. G. Chaplin, 1993; Claro, R., 1994; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. During courtship, the male follows the female closely then both rush to the surface to spawn (Ref. 205). At this point, eggs are produced in a gelatinous floating mass or 'raft' and inseminated by the male. The eggs remain embedded in this raft until hatching (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female produces eggs that raft together in open water, which are then fertilized by a male.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Pietsch, T. W. and D. B. Grobecker, 1987; B?e, J. E. and C. C. G. Chaplin, 1993; Claro, R., 1994; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Histrio histrio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTTGTATTCGGCGCATGAGCCGGCATAGTGGGAACAGCCCTCAGCCTGCTAATTCGTGCAGAGCTAAGTCAACCAGGCGCACTTTTAGGCGATGATCAAATTTATAATGTTATCGTCACAGCGCACGCTTTCGTTATAATCTTTTTTATAGTTATGCCAATTATAATCGGCGGATTCGGCAATTGACTAATCCCATTAATAATTGGCGCACCAGACATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTTTTACCTCCATCTTTTCTCCTTCTATTAGCATCATCGGGAGTAGAAGCTGGGGCAGGTACGGGATGAACAGTTTACCCGCCTCTTGCAGGCAACCTGGCCCACGCCGGAGCATCCGTTGATCTAACTATTTTCTCACTGCACCTCGCAGGTGTATCATCCATTTTAGGGGCTATTAATTTTATTACAACTATTATTAATATAAAACCCCCGGCCCTTTCACAATACCAAACACCATTATTTGTATGAGCTGTGTTGGTCACTGCTGTCCTACTTCTTCTCTCTCTTCCTGTTCTTGCTGCAGGAATCACAATGCTACTGACCGATCGAAACCTAAATACGACCTTTTTTGATCCTACAGGCGGAGGGGACCCTATTCTTTATCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Histrio histrio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

The only commercial value of the Sargassum Fish is in the aquarium trade (Boschung et al. 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sargassumfish

Histrio histrio, commonly the sargassum fish, anglerfish or frog fish,[2] is a frogfish of the family Antennariidae, the only species in its genus, Histrio. It lives among Sargassum seaweed which floats in subtropical oceans.[3] The scientific name comes from the Latin "histrio" meaning a stage-player or actor, and refers to the fish's feeding behaviour.[4]

Contents

Description

Illustration of a sargassum fish.

Histrio histrio is a strange-looking fish that blends well with its surroundings in its seaweed habitat. It is laterally compressed and its length can reach 20 centimeters (7.9 in). The colour of the body and the large oral cavity is very variable but is usually mottled and spotted yellow, green and brown on a paler background and the fins often have several dark streaks or bands. The fish can change colour rapidly, from light to dark and back again.[2] Both the body and the fins are covered with many weed-like protrusions, but other than these, the skin is smooth without dermal spines. The dorsal fin has 3 spines and 11–13 soft rays. The front spine is modified into a slender growth on the upper lip known as an illicium, which is tipped by a fleshy lump, the esca. The junction between the head and body is indistinct because there are no gill slits, the gills opening as pores near the base of the pectoral fins.[5] The anal fin has no spines and 7–13 soft rays. The pelvic fins are large and the pectoral fins have 9-11 rays and are stalked and able to grip objects. The outer rays of the tail fin are simple but the central rays are forked.[2][6][7]

Distribution and habitat

Histrio histrio has a cosmopolitan distribution in tropical and subtropical seas down to a depth of about 10 metres (33 ft). It is found in parts of the Atlantic Ocean and the Indo-Pacific Ocean where drifting seaweed accumulates. In the western Atlantic it ranges from the Gulf of Maine south to Uruguay. It has been reported from northern Norway but that sighting is likely to be as a result of its having been carried along by the North Atlantic Current.[1][2]

Biology

Histrio histrio is a voracious ambush predator that is also a cannibal.[2] One individual was dissected and found to have 16 juveniles in its stomach.[7] It stalks its prey among the tangled weed relying on its cryptic camouflage for concealment. It can clamber through and cling to the seaweed stalks with its prehensile pectoral fins. It dangles its esca as a fishing lure to attract small fish, shrimps and other invertebrates. It is able to dart forward to grab its prey by expelling water forcibly through its gill openings. It can expand its mouth to many times its original size in a fraction of a second, drawing prey in via suction, and can swallow prey larger than itself.[7]

Histrio histrio is dioecious. At breeding time, the male courts the female by following her around closely. When ready to spawn, the female ascends rapidly to the surface where she lays a mass of eggs stuck together by gelatinous mucus. This egg raft adheres to the seaweed where it is fertilised by the male. On hatching, each larva is surrounded by an integumentary envelope and has a large, rounded head, fully formed fins and eyes with double notches. As the larva develops into a juvenile, this envelope fuses with the skin.[5]

Histrio histrio is itself preyed on by larger fish and sea birds. To avoid underwater threats it can leap above the surface onto mats of weed. It can survive for some time out of water.[5]

References

  1. ^ a b Bailly, Nicolas (2010). "Histrio histrio (Linnaeus, 1758)". World Register of Marine Species. Retrieved 2012-01-04. 
  2. ^ a b c d e Frogfish (Histrio histrio) Marine Species Identification Portal. Retrieved 2012-01-04.
  3. ^ Ayling, Tony; Geoffrey Cox (1982). Collins Guide to the Sea Fishes of New Zealand. Auckland, New Zealand: William Collins Publishers. ISBN 0-00-216987-8. 
  4. ^ Histrio Charlton T. Lewis, Charles Short, A Latin Dictionary. Retrieved 2012-01-04.
  5. ^ a b c Biological profiles: Sargassumfish Florida Museum of Natural History. Retrieved 2012-01-04.
  6. ^ Histrio histrio - (Linnaeus, 1758) FishBase. Retrieved 2012-01-04.
  7. ^ a b c Nature's Fast Feeder: The Frogfish Bahamas Wildlife. Retrieved 2012-01-04.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!