Overview

Comprehensive Description

Biology

Found on soft bottoms (Ref. 2850). Viviparous (Ref. 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: southeastern Kamchatka to Navarin Canyon in the Bering Sea, Stalemate and Bowers Banks and the Aleutian Islands south to Point Conception, California, USA. Reported from southern Japan (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13; Analspines: 3; Analsoft rays: 7; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1080 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

108 cm TL (male/unsexed; (Ref. 27437)); max. published weight: 16.2 kg (Ref. 40637); max. reported age: 157 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head spines strong to moderate - nasal, preocular, supraocular, postocular, tympanic, coronal (may be absent), parietal and nuchal spines present (Ref. 27437). Less than 2 spines on lower orbital rim; very large pores on lower jaw (Ref. 27437). Caudal fin moderately indented (Ref. 6885). Reddish pink to orange red; mouth red and may have black blotches (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 0 - 1200 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 163.5 - 595
  Temperature range (°C): 3.475 - 7.168
  Nitrate (umol/L): 27.264 - 42.732
  Salinity (PPS): 33.811 - 34.096
  Oxygen (ml/l): 0.692 - 3.194
  Phosphate (umol/l): 2.232 - 3.097
  Silicate (umol/l): 40.664 - 116.417

Graphical representation

Depth range (m): 163.5 - 595

Temperature range (°C): 3.475 - 7.168

Nitrate (umol/L): 27.264 - 42.732

Salinity (PPS): 33.811 - 34.096

Oxygen (ml/l): 0.692 - 3.194

Phosphate (umol/l): 2.232 - 3.097

Silicate (umol/l): 40.664 - 116.417
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 875m.
Recorded at 875 meters.

Habitat: bathydemersal. A little known species that is found on soft bottom.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 157 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sebastes borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sebastes borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTACTACTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCTGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAATACCAGACACCCCTATTTGTGTGAGCGGTCCTAATTACCGCTGTCCTTCTCCTTCTCTCTCTACCAGTTCTCGCTGCCGGCATCACTATACTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGAGGAGGGGATCCAATCCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Shortraker rockfish

Shortraker rockfish (Sebastes borealis) is an offshore, demersal species distributed from the southeastern Kamchatka Peninsula, Russia, to Fort Bragg, California.[1] It attains lengths greater than one metre (>39 inches) and weighs up to 20 kg (44 pounds). In the Gulf of Alaska, shortraker rockfish are sampled annually during longline surveys and are most abundant between depths of 300–400 metres (980–1,310 ft).

Commercial harvesting in the Gulf of Alaska began in the early 1960s when foreign trawl fleets were targeting more abundant.[2][full citation needed] In recent years, high catch rates indicate that the domestic trawl fleet targets this species; shortraker rockfish comprised 14.9% of the species composition of slope rockfish harvested in 1990, although trawl survey data indicates they comprised only 2.5% of the biomass.[3]

In 1991, catch limits were established for shortraker rockfish to prevent overharvesting of this species in the Gulf of Alaska. Catch limits are based on biomass estimates derived from bottom trawl catch rates. These biomass estimates are questionable, however, because the catch efficiency of bottom trawls on shortrakers is unknown. Fishermen report that shortrakers school off-bottom and above rugged habitat in steep-slope areas where bottom trawls cannot sample effectively.[4]

Old specimens[edit]

In 2007, fishermen caught a specimen that was estimated to be between 90 and 115 years old. The fish weighed in at 62 pounds (28 kg) and was measured at 112 centimetres (44 in). It was caught south of the Pribilof Islands at an estimated depth of 2,100 feet (640 m).[5][6][7][8]

In 2013, a sport fisherman from Seattle caught a specimen from 900 feet (270 m) below the surface and 10 miles offshore near Sitka, Alaska.[9][10] At 39.08 pounds (17.73 kg), experts believe the 42-inch shortraker is the oldest ever caught, with an estimated age of 200 years.[9][10] Update: Fish was found to be 64 years old.[11]

References[edit]

  1. ^ Kramer, D.E.; O'Connell, V.M. (1986). "Guide to northeast Pacific rockfishes". Marien Advisory Bulletin (Alaska Sea Grant College Program, University of Alaska Fairbanks) (25). 
  2. ^ Sebastes spp
  3. ^ Heifetz and Clausen, 1991
  4. ^ Encyclopedia.com[dead link]
  5. ^ Century-old fish found off Alaska BBC News, 2007-04-06. Retrieved 2007-04-07.
  6. ^ The Sideshow (July 2, 2013). "Man catches 200-year-old, 40-pound fish". News.Yahoo.com. Retrieved 2013-07-09. 
  7. ^ Photo in the News: Century-Old Fish Caught in Alaska National Geographic, 2007-04-06. Retrieved 2007-04-07
  8. ^ Joling, Dan (2007-04-06). "Fishermen catch big, old Alaska rockfish". Yahoo! News (Yahoo! Inc.). Archived from the original on 2007-04-08. Retrieved 2007-04-09. 
  9. ^ a b Barber, Elizabeth (3 July 2013). "200-year-old rockfish caught off Alaska coast". The Christian Science Monitor. Retrieved 4 July 2013. 
  10. ^ a b Hesse, Tom (25 June 2013). "Record-Sized Rockfish May Also be the Oldest". Daily Sitka Sentinel. Retrieved 4 July 2013. 
  11. ^ Pooch, Andrew (5 July 2013). "Record "Old" Rockfish Aged at 64 Years". Angling Unlimited. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!