Overview
Comprehensive Description
Biology
Found in shallow water and observed to be active only at night, near the bottom, and never far from its shelter (Ref. 27665). Benthopelagic (Ref. 58302).
-
Greenfield, D.W. 2001 Revision of the Apogon erythrinus complex (Teleostei: Apogonidae). Copeia 2001(2):459-472. (Ref. 40822)
http://www.fishbase.org/references/FBRefSummary.php?id=40822&speccode=12998
Trusted
Distribution
Eastern Central Pacific: known only from the Hawaiian Islands and Johnston Island. Reports of occurrence in other Indo-West Pacific countries are questionable.
-
Randall, J.E. 1998 Review of the cardinalfishes (Apogonidae) of the Hawaiian Islands, with descriptions of two new species. Aqua 3(1):25-38. (Ref. 27665)
http://www.fishbase.org/references/FBRefSummary.php?id=27665&speccode=51830
Trusted
Chagos, South Africa (country)
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Physical Description
Morphology
Dorsal spines (total): 7; Dorsal soft rays (total): 8 - 9; Analspines: 2; Analsoft rays: 8
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Size
Max. size
4.0 cm SL (male/unsexed; (Ref. 40822))
-
Greenfield, D.W. 2001 Revision of the Apogon erythrinus complex (Teleostei: Apogonidae). Copeia 2001(2):459-472. (Ref. 40822)
http://www.fishbase.org/references/FBRefSummary.php?id=40822&speccode=12998
Trusted
Diagnostic Description
Differs from other members of the A. erythrinus complex by having the following characteristics: from all others by having a much longer second dorsal fin spine, reaching to at least the base of third ray of second dorsal fin when depressed (spine in other species do not reach third ray); from A. indicus by having 14 pectoral fin rays (versus 13, rarely 12 or 14), and by lacking pigment on the dorsal surface of the caudal peduncle (present in A. indicus); from A. marquesensis by lacking scattered chromatophores on sides of caudal peduncle that extend anteriorly as a band from caudal fin base to vertical from ends of dorsal and anal fin rays (pigment extends forward as a band in A. marquesensis); from A. susanae by having pigment present on scale edges at front of second dorsal fin and sometimes along its base and scattered chromatophores on caudal fin base (absent in A. susanae) (Ref. 40822).
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Type Information
Type for Apogon erythrinus
Catalog Number: USNM 50876
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Puako R., Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 50876
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Puako R., Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Type:
Trusted
Cotype for Apogon erythrinus
Catalog Number: USNM 55316
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Puako Bay, Hawaii., Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 55316
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Puako Bay, Hawaii., Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Cotype:
Trusted
Cotype for Apogon erythrinus
Catalog Number: USNM 55321
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Laysan Is., Laysan, Northwestern Hawaiian Islands, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 55321
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Laysan Is., Laysan, Northwestern Hawaiian Islands, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Cotype:
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 1 - 48 m (Ref. 58302)
-
Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
http://www.fishbase.org/references/FBRefSummary.php?id=58302&speccode=46
Trusted
Depth range based on 187 specimens in 1 taxon.
Water temperature and chemistry ranges based on 150 samples.
Environmental ranges
Depth range (m): 0.55 - 46
Temperature range (°C): 24.610 - 29.336
Nitrate (umol/L): 0.047 - 2.714
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.387 - 4.835
Phosphate (umol/l): 0.071 - 0.507
Silicate (umol/l): 0.888 - 3.521
Graphical representation
Depth range (m): 0.55 - 46
Temperature range (°C): 24.610 - 29.336
Nitrate (umol/L): 0.047 - 2.714
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.387 - 4.835
Phosphate (umol/l): 0.071 - 0.507
Silicate (umol/l): 0.888 - 3.521
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 150 samples.
Environmental ranges
Depth range (m): 0.55 - 46
Temperature range (°C): 24.610 - 29.336
Nitrate (umol/L): 0.047 - 2.714
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.387 - 4.835
Phosphate (umol/l): 0.071 - 0.507
Silicate (umol/l): 0.888 - 3.521
Graphical representation
Depth range (m): 0.55 - 46
Temperature range (°C): 24.610 - 29.336
Nitrate (umol/L): 0.047 - 2.714
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.387 - 4.835
Phosphate (umol/l): 0.071 - 0.507
Silicate (umol/l): 0.888 - 3.521
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Feeds on fish and worms (Ref. 275).
-
Hiatt, R.W. and D.W. Strasburg 1960 Ecological relationships of the fish fauna on coral reefs of the Marshall Islands. Ecol. Monogr. 30(1):65-127. (Ref. 275)
http://www.fishbase.org/references/FBRefSummary.php?id=275&speccode=4738
Trusted
Life History and Behavior
Life Cycle
Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
-
Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
http://www.fishbase.org/references/FBRefSummary.php?id=240&speccode=1263
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Apogon erythrinus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTTTATTTAGTATTTGGTGCTTGGGCCGGAATAGTCGGGACTGCACTTAGCCTCCTCATTCGAGCTGAGCTAAGTCAACCCGGGGCTCTCCTCGGCGATGACCAAATTTATAACGTAATCGTTACAGCGCACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAATTGATTAATCCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCACGAATAAACAATATGAGCTTCTGACTCCTCCCTCCCTCTTTCCTTCTTCTGCTTGCCTCCTCCGGCGTAGAGGCCGGAGCCGGGACAGGATGAACCGTGTACCCCCCTCTTGCAGGCAACCTTGCCCATGCAGGAGCTTCTGTTGACTTAACAATCTTTTCCCTGCATCTCGCTGGTGTGTCATCAATTCTGGGGGCAATTAATTTCATTACTACAATTATTAATATGAAACCCCCTGCTATTACTCAGTATCAGACACCACTATTTGTGTGAGCAGTCCTAATTACTGCAGTCCTTCTTCTCCTTTCTCTGCCTGTTCTAGCAGCTGGCATTACAATGCTTCTTACAGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGTGGTGGGGACCCAATCCTTTATCAACACTGT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Apogon erythrinus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


