Overview

Comprehensive Description

Biology

Found in shallow water and observed to be active only at night, near the bottom, and never far from its shelter (Ref. 27665). Benthopelagic (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: known only from the Hawaiian Islands and Johnston Island. Reports of occurrence in other Indo-West Pacific countries are questionable.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 8 - 9; Analspines: 2; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

4.0 cm SL (male/unsexed; (Ref. 40822))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from other members of the A. erythrinus complex by having the following characteristics: from all others by having a much longer second dorsal fin spine, reaching to at least the base of third ray of second dorsal fin when depressed (spine in other species do not reach third ray); from A. indicus by having 14 pectoral fin rays (versus 13, rarely 12 or 14), and by lacking pigment on the dorsal surface of the caudal peduncle (present in A. indicus); from A. marquesensis by lacking scattered chromatophores on sides of caudal peduncle that extend anteriorly as a band from caudal fin base to vertical from ends of dorsal and anal fin rays (pigment extends forward as a band in A. marquesensis); from A. susanae by having pigment present on scale edges at front of second dorsal fin and sometimes along its base and scattered chromatophores on caudal fin base (absent in A. susanae) (Ref. 40822).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Apogon erythrinus
Catalog Number: USNM 50876
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Puako R., Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Apogon erythrinus
Catalog Number: USNM 55316
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Puako Bay, Hawaii., Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Apogon erythrinus
Catalog Number: USNM 55321
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Laysan Is., Laysan, Northwestern Hawaiian Islands, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 48 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 187 specimens in 1 taxon.
Water temperature and chemistry ranges based on 150 samples.

Environmental ranges
  Depth range (m): 0.55 - 46
  Temperature range (°C): 24.610 - 29.336
  Nitrate (umol/L): 0.047 - 2.714
  Salinity (PPS): 33.507 - 36.148
  Oxygen (ml/l): 4.387 - 4.835
  Phosphate (umol/l): 0.071 - 0.507
  Silicate (umol/l): 0.888 - 3.521

Graphical representation

Depth range (m): 0.55 - 46

Temperature range (°C): 24.610 - 29.336

Nitrate (umol/L): 0.047 - 2.714

Salinity (PPS): 33.507 - 36.148

Oxygen (ml/l): 4.387 - 4.835

Phosphate (umol/l): 0.071 - 0.507

Silicate (umol/l): 0.888 - 3.521
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on fish and worms (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apogon erythrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCTTGGGCCGGAATAGTCGGGACTGCACTTAGCCTCCTCATTCGAGCTGAGCTAAGTCAACCCGGGGCTCTCCTCGGCGATGACCAAATTTATAACGTAATCGTTACAGCGCACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAATTGATTAATCCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCACGAATAAACAATATGAGCTTCTGACTCCTCCCTCCCTCTTTCCTTCTTCTGCTTGCCTCCTCCGGCGTAGAGGCCGGAGCCGGGACAGGATGAACCGTGTACCCCCCTCTTGCAGGCAACCTTGCCCATGCAGGAGCTTCTGTTGACTTAACAATCTTTTCCCTGCATCTCGCTGGTGTGTCATCAATTCTGGGGGCAATTAATTTCATTACTACAATTATTAATATGAAACCCCCTGCTATTACTCAGTATCAGACACCACTATTTGTGTGAGCAGTCCTAATTACTGCAGTCCTTCTTCTCCTTTCTCTGCCTGTTCTAGCAGCTGGCATTACAATGCTTCTTACAGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGTGGTGGGGACCCAATCCTTTATCAACACTGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apogon erythrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!