Overview

Brief Summary

Biology

The common jellyfish is carnivorous, and feeds mainly on a variety of planktonic species such as molluscs, crustaceans, young worms and copepods (3). The plankton is caught in a layer of mucus that covers the jellyfish. Tiny hair-like structures called 'cilia' on the body of the jellyfish produce currents by beating. These currents transport the captured plankton towards the edge of the 'bell', where it is removed with the arms and passed to the mouth (2). The tentacles around the margins of the bell and the arms bear stinging cells, which are occasionally used to catch small fishes and other prey (2). The sexes are separate and fertilisation occurs internally; the sperm is taken into the female's body via the mouth (2). The fertilised eggs undergo development in pockets in the arms that surround the mouth. The free-swimming larvae (known as 'planulae' larvae) are released during autumn; after some time these larvae settle and develop into tiny sessile animals ('scyphistomae'), which reproduce asexually and release free-swimming tiny immature jellyfish (called 'ephyrae'), which feed on plankton and become mature after around 3 months (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Lifestyle

Like anemones and corals, the moon jellyfish is a cnidarian, which means it has a sac-like body with a mouth and tentacles. The moon jellyfish spends its time floating near the surface of the water, waiting for food to float by. It can be as small as 2 inches (5 cm) or grow over 1 foot wide (30 cm). It can be found along reefs and all over the world, and can float by itself or in groups of hundreds!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Body clear, often with purple canals and tentacles.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Aurelia aurita has a smooth, flattened saucer-shaped bell (the umbrella) with eight simple marginal lobes. The umbrella is colourless, while the radial canals, oral arms and gonads are typically mauve, violet, reddish, pink or yellowish in colour. Aurelia aurita usually grows to approximately 25 cm in diameter but can reach 40 cm. The umbrella is quite thick, thinning towards the edge, with numerous short, hollow tentacles forming a fringe around the edge. These short tentacles are ringed by numerous stinging cells (nematocysts). There are four interfolded gonads that form a horseshoe or near circle shape in the centre of the umbrella. Eight branched and eight un-branched canals connect to the marginal ring-canal of the umbrella. The mouth is formed on a projection on the underside of the umbrella (the manubrium). Four thickened oral arms, each with a central groove, edged by thinner folded lips and lined with small tentacle-like processes approximately 2 mm long. The surface of the oral arms is covered with nematocysts, crowded together near the tips of the tentacles. The oral arms are slightly shorter than the radius of the umbrella. The stomach consists of four circular shaped interradial gastric pouches connected to the mouth by grooves.Aurelia aurita has an interesting life history. The sexes are separate, the sperm are taken into the female via the mouth and fertilization occurs internally. Pits in the oral arms act as a temporary brood chamber holding the eggs until they develop into free-swimming larvae (planula larvae). Following a brief swimming period the planulae attach to hard substratum and develop into tiny sessile animals (scyphistomae). These reproduce by asexual budding and release free-swimming tiny immature jellyfish (ephyrae). The ephyrae feed on plankton and will generally reach maturity at around 3 months. However, some ephyrae may take up to two years to grow into sexually-reproducing adult medusae (Ruppert & Barnes, 1994). 

Aurelia aurita feed, but not exclusively, on plankton and can at times occur in massive swarms, which may be so dense as to give the sea a uniform red colour and slow the passage of small boats (Russell, 1970).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The moon jellyfish is one of the most common kinds of jellyfish, yet is also one of the strangest animals on the reef. It is a floating sac with a mouth and arms. It can swim, but not to get from one place to another. It is happy to float along, but it needs to make sure that it can stay near the surface of the water, so that its thin tentacles have lots of room to hang and catch food. When its prey brush up against its tentacles, it fires thousands of stinging cells, or nematocysts, to poison them! Its tentacles bring the poisoned prey into its mouth to eat. Other jellyfish can kill humans with their stinging cells, but the moon jellyfish’s nematocysts don’t bother people much at all.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This is the most common jellyfish on British shores (2). The body is a saucer shaped 'bell', which is colourless except for 4 obvious violet gonads visible in the centre of the disc (2). The outer edges are fringed with many small tentacles (4), and four stocky 'arms' surround the mouth (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Moon Jellies are the most common types of jellyfish. They are easily recognizable by its four violet or pink crescent shaped gonads on the underside and at the centre of its translucent bell or umbrella (Aurelia aurita - Moon Jelly).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Aurelia aurita are found near the coast, in mostly warm and tropical waters (but they can withstand temperatures as low as -6 and as high as 31 degrees Celsius). They are prevalent in both inshore seas and oceans.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

semi-cosmopolitan
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Cosmopolitan species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic to Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Coast, Belgian Exclusive Economic Zone, Bredene, Bulgarian Exclusive Economic Zone, De Panne, Duinbergen, Dutch Exclusive Economic Zone, European waters (ERMS scope), Georgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Halve Maan, Irish Exclusive economic Zone, New Zealand Exclusive Economic Zone, North West Atlantic, Oostduinkerke, Oostende, Polish Exclusive Economic Zone, Red Sea, Romanian Exclusive economic Zone, Russian Exclusive economic Zone [Black Sea part], Turkish Exclusive Economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Zeebrugge
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found around all British coasts (2). It is a northern hemisphere species, found in the Atlantic, Pacific, and Indian Oceans (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These animals range between 5 and 40 cm.. They can be recognized by their delicate and exquisite coloration, often in patterns of spots and streaks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

Umbrella flattened; the center of the subumbrella carries a mouth proboscis with 4 long feeding tentacles. The edge of the disk carries numerous short tentacles and 8 rhopalia. Canals of the gastric system are branched, often with anastamosi.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Diameter up to 30-40 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Width 15-30 cm. Bell flat to domed, firm, translucent, with four (or 5-7) bluish-pink gonad rings, four mouth-arms and hundreds of fine marginal tentacles. Swarms. Habitat: coastal. Distribution: all seas (Richmond, 1997).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Their habitat includes the costal waters of all zones, and they occur in huge numbers. They are known to live in brackish waters with as low a salt content as 0.6%. Decreased salinity in the water diminishes the bell curvature, and vice versa. An optimum temperature for the animals is 9 - 19 degrees Celsius.

Aquatic Biomes: reef ; lakes and ponds; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

coastal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

upper epipelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 137 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0 - 365.1
  Temperature range (°C): -1.405 - 28.609
  Nitrate (umol/L): 0.309 - 38.262
  Salinity (PPS): 17.801 - 36.367
  Oxygen (ml/l): 0.790 - 8.585
  Phosphate (umol/l): 0.227 - 2.962
  Silicate (umol/l): 1.626 - 72.502

Graphical representation

Depth range (m): 0 - 365.1

Temperature range (°C): -1.405 - 28.609

Nitrate (umol/L): 0.309 - 38.262

Salinity (PPS): 17.801 - 36.367

Oxygen (ml/l): 0.790 - 8.585

Phosphate (umol/l): 0.227 - 2.962

Silicate (umol/l): 1.626 - 72.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Aurelia aurita is Britains most common jellyfish. It is sporadic in its appearance, forming massive local populations in some areas but totally absent in other areas for some years. Aurelia aurita is a pelagic species but may be found washed up on the shore. It is known to occur up estuaries and into harbours and is especially common in Scottish sea lochs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Typically found close to the coast, this jellyfish can also be found in estuaries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

"Aurelia aurita are found near the coast, in mostly warm and tropical waters, but they can withstand temperatures as low as -6°C and as high as 31 degrees celsius" (Aurelia aurita, Moon jellyfish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Saucer Jelly is carnivorous and feeds on plankton. Their primary foods include small plankton organisms such as mollusks, crustaceans, tunicate larvae, copepods, rotifers, nematods, young polychaetes, protozoans, diatoms, and eggs. They are also sometimes observed to eat small hydromedusae and ctenophores. These foods collect chiefly on the surface of the animal, where they become entangled in mucus. Food items are then passed on to the margins by flagellar action, where they collect on the lappets. They are then moved, again by flagellar currents, along eight separate canals, which are unique to this species of jellyfish. These canals branch off and run into the stomach, and they bring the food to it via the ring canal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

“The moon jelly is a carnivore and it feeds on zooplankton.” They consume foods that include small plankton organisms like mollusks, crustaceans, tunicate larvae, copepods, rotifers, nematodes, young polychaetes, protozoan's, diatoms and eggs (Aurelia aurita, Moon jellyfish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

The moon jellyfish eats tiny animals that live in the ocean called zooplankton. Because it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life Cycle

"Aurelia aurita has two main stages in its life cycle – the polyp stage (asexual reproduction) and the medusa stage (sexual reproduction). A mature polyp reproduces asexually, known as budding forming an entire colony of polyps. Polyps specializing in reproduction produce ephyra (small medusae) by budding. The medusae swim off and mature. They then reproduce sexually. From the egg and the sperm of two medusae, a zygote is formed. The zygote develops into a planula (larva). The planula larva leaves the adult medusae, finds a shaded surface, and attaches itself to it. The planula eventually develops into a new polyp, and the life cycle of the Aurelia aurita starts again" (Aurelia aurita - Moon Jelly).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Sexual maturity in Aurelia aurita commonly occurs in the spring and summer. The eggs develop in gonads located in pockets formed by the frills of the oral arms. The gonads are commonly the most recognizable part of the animal, because of their deep and conspicuous coloration. The gonads lie at the bottom of the stomach. Males and females are distinct and reproduction is sexual.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

"Sexual maturity in Aurelia aurita commonly occurs in the spring and summer". “The eggs develop in gonads located in pockets formed by the frills of the oral arms. The gonads are commonly the most recognizable part of the animal because of their deep and conspicuous coloration. The gonads lie near the bottom of the stomach” (Aurelia aurita, Moon jellyfish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Vortex rings propel: moon jellyfish
 

Moon jellyfish move efficiently through water by creating complex vortex rings in the wake of their motion.

   
  "Through his research, Dabiri has observed that moon jellyfish don't  move through water simply by using jet propulsion. Instead, they create  complex vortex rings in the wake of their motion that allow them propel  themselves forward. Cracking the code to how jellyfish create these currents has the  potential to inform the development of future propulsion models. On the  horizon are possible advances in underwater transportation or medical  technologies administered through the blood stream." (Halverson 2011:1)

  Learn more about this functional adaptation.
  • Halverson N. 2011. Moving toward Jellyfish-inspired propulsion. DiscoveryNews [Internet], Accessed 14 July 2011.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aurelia aurita

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCI0756-06|DQ787873|Aurelia aurita| TCAAGATGATTATTCTCAACTAACCACAAAGATATAGGAACACTATACTTAATATTTGGTGCTTTTTCCGCCATGGTGGGAACTGCCTTC---AGTATGATTATAAGACTGGAACTATCAGGCCCAGGATCCATGTTGGGGGAC---GATCAACTATATAACGTTGTAGTGACCGCTCATGCTCTTATAATGATTTTCTTTTTCGTAATGCCCGTTTTGATAGGGGGATTTGGAAACTGGCTAGTTCCCCTA---TATATAGGAGCTCCAGATATGGCCTTTCCAAGGCTTAACAATATCAGTTTCTGATTATTACCTCCAGCTTTATTACTATTATTAGGGTCTTCCCTTATAGAACAAGGAGCAGGTACTGGTTGAACCATTTACCCTCCTTTAAGTTCAATACAAGCTCATTCTGGGGGTTCAGTAGATATG---GCCATATTTAGTCTTCATTTAGCAGGAGCTTCCTCTATTATGGGTGCTATTAACTTTATTACCACTATTTTAAATATGAGAGCCCCTGGTATGACCATGGATAGAATACCTTTATTCGTATGATCTGTATTAGTTACTGCAATCTTATTATTGTTGTCCTTACCCGTATTAGCTGGG---GCAATTACCATGTTGTTGACTGATAGAAATTTCAACACATCCTTCTTTGACCCTGCTGGAGGAGGAGATCCAATACTATTCCAACATTTATTTTGGTTTTTTGGACACCCAGAAGTGTATATATTGATTCTACCCGGATTTGGAATTGTATCTCAGATAATACCAACATTTTCTTCTAAGAAA---CAAATATTTGGGTATCTAGGAATGGTCTATGCTATGATAGCTATAGGTATACTTGGATTTATAGTTTGGGCTCACCATATGTTTACAGTTGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aurelia aurita

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

They are very plentiful.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

WhyReef - Threats

Moon jellyfish have no natural predators, but can harm the reef if there are too many of them. Moon jellyfish eat zooplankton (tiny animals), who in turn eat tiny plants in the sea called phytoplankton. If the moon jellyfish eat all the zooplankton, then there is nothing to eat the tiny phytoplankton and they grow out of control! They multiply so greatly that they can start to block out the sun!! This can then start to kill the corals and plants in the reef.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Predation on copepods and fish larvae. May significantly affect a plankton community through predation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Represent an important step in pelagic organic matter transformations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aurelia aurita

Aurelia aurita (moon jelly, moon jellyfish, common jellyfish, saucer jelly) is one of a group of more than ten morphologically nearly identical jellyfish species in the genus Aurelia.[1] In general, it is nearly impossible to identify Aurelia medusae without genetic sampling, so most of what follows about Aurelia aurita, could equally be applied to any species of the genus. The medusa is translucent, usually about 25–40 cm in diameter, and can be recognized by its four horseshoe-shaped gonads that are easily seen through the top of the bell. It feeds by collecting medusae, plankton and mollusks with its mucusy bell nematocyst-laden tentacles and bringing the prey into its body for digestion, but is capable of only limited motion; like other jellies it primarily drifts with the current, even when it is swimming.

Contents

Distribution

The cosmopolitan genus Aurelia is found throughout most of the world's oceans, from the tropics to as far north as 70° latitude and as far south as 40°.[2] The species Aurelia aurita, whose distribution has been confirmed by Michael Dawson using genetic analysis, is found along the eastern Atlantic coast of Northern Europe and the western Atlantic coast of North America in New England and Eastern Canada.[3] In general, Aurelia is an inshore genus that can be found in estuaries and harbors.[4] It lives in ocean water temperatures ranging from 6 °C to 31 °C; with optimum temperatures of 9 °C to 19 °C. A. aurita prefers temperate seas with consistent currents. It has been found in waters with salinity as low as 6 parts per thousand.[5]

Feeding

A. aurita and other Aurelia species feed on plankton that includes organisms such as mollusks, crustaceans, tunicate larvae, rotifers, young polychaetes, protozoans, diatoms, eggs, fish eggs, and other small organisms. Occasionally, they are also seen feeding on gelatinous zooplankton such as hydromedusae and ctenophores.[5] Both the adult medusae and larvae of Aurelia have nematocysts to capture prey and also to protect themselves from predators. The food is tied with mucus, and then it is passed down by ciliated action down into the gastrovascular cavity where digestive enzymes from serous cell break down the food. There is little known about the requirements for particular vitamins and minerals, but due to the presence of some digestive enzymes, we can deduce in general that A. aurita can process carbohydrates, proteins and lipids.[6]

Filtering Grid of Tentacles on the Bell Margin

Aureliaauritakils1.jpg

High resolution in situ image of an undulating live Aurelia in the Baltic showing the grid of tentacles which are slowly pulled through the water. The motion is so slow that copepods can not sense it and don't react with an escape response

Aureliaauritakils2.jpg

Higher magnification showing a prey item, probably a copepod

Aureliaauritakils3.jpg

The prey is then drawn to the body by contracting the tentacles in a corkscrew fashion (image taken with an ecoSCOPE).

Body system

This picture shows an anomaly in the number of gonads. Most Aurelias have 4 gonads.[2]

Aurelia does not have respiratory parts such as gills, lungs, or trachea. Since it is a small organism, it respires by diffusing oxygen from water through the thin membrane. Within the gastrovascular cavity, low oxygenated water can be expelled and high oxygenated water can come in by ciliated action, thus increasing the diffusion of oxygen through cell.[7] The large surface area membrane to volume ratio helps Aurelia to diffuse more oxygen and nutrients into the cells.

The basic body plan of Aurelia consists of several parts. The animal lacks respiratory, excretory, and circulatory systems. The adult medusa of Aurelia, with a transparent look, has an umbrella margin membrane and tentacles that are attached to the bottom.[4] It has four bright circular gonads that are under the stomach.[2] Food travels through the muscular manubrium while the radial canals help disperse the food.[4] There is a middle layer of mesoglea, gastrodervascular cavity with gastrodermis, and epidermis.[8] There is a nerve net that is responsible for contractions in swimming muscles and feeding responses.[6] Adult medusa can have a diameter up to 40 cm.[6]

The medusae are either male or female.[6] The young larval stage, a planula, has small ciliated cells and after swimming freely in the plankton for a day or more, settles on an appropriate substrate, where it changes into a special type of polyp called a "scyphistoma", which divides by strobilation into small ephyrae that swim off to grow up as medusae.[9][10] There is an increasing size from starting stage planula to ephyra, from less than 1 mm in the planula stage, up to about 1 cm in ephyra stage, and then to several cm in diameter in the medusa stage.[4]

Predators

Aurelia aurita is known to be eaten by a wide variety of predators including the Ocean Sunfish (Mola mola), the Leatherback Sea Turtle (Dermochelys coriacea), the scyphomedusa Phacellophora camtschatica,[11][12] and a very large hydromedusa (Aequorea victoria).[6] Moon jellies are also fed upon by sea birds, which may be more interested in the amphipods and other small arthropods that frequent the bells of Aurelia, but in any case, birds do some substantial amount of damage to these jellyfish that often are found just at the surface of bays.

Aurelia jellyfish naturally die after living and reproducing for several months. It is probably rare for these moon jellies to live more than about six months in the wild, although specimens cared for in public aquarium exhibits typically live several to many years. In the wild, the warm water at the end of summer combines with exhaustive daily reproduction and lower natural levels of food for tissue repair, leaving these jellyfish more susceptible to bacterial and other disease problems that likely lead to the demise of most individuals. Such problems are responsible for the demise of many smaller species of jellyfish.[13] In 1997, Arai summarized that seasonal reproduction leaves the gonads open to infection and degradation.[6]

Some metazoan parasites attack Aurelia aurita, as well as most other species of jellyfish.[6]

References

  1. ^ Dawson, Michael N. "Aurelia species". http://www2.eve.ucdavis.edu/mndawson/tS/Org/JotQ/JotQ_03Oct.html. Retrieved 2008-08-12. 
  2. ^ a b c Purcell, J. E., W.M. Graham, and H.J. Dumont (Eds.). 2001. Jellyfish Blooms: Ecological and Societal Importance. Kluwer Academic Publishers, Dordrecht, 229-273
  3. ^ Dawson, M.N. 2003. Macro-morphological variation among cryptic species of the moon jellyfish, "Aurelia" (Cnidaria: Scyphozoa). Marine Biology 143: 369-379. doi:10.1007/s00227-003-1070-3
  4. ^ a b c d Russell, F. S. 1953. The Medusae of the British Isles II. Syndics of Cambridge University Press, London, 81-186
  5. ^ a b Rodriguez, R. J. February 1996. Aurelia aurita (Saucer Jelly, Moon Jelly, Common Sea Jelly Jellyfish) Narrative
  6. ^ a b c d e f g Arai, M. N. 1997. A Functional Biology of Scyphozoa. Chapman and Hall, London, 68-206
  7. ^ Rees, W. J. 1996. The Cnidaria and Their Evolution. Academic Press Inc, NY, 77-104
  8. ^ Solomon, E. P., L. R. Berg, and W. W. Martin. 2002. Biology 6th edition. Brooks/Cole Publishing, CA, 602-608
  9. ^ Tree of Life - NJ Jellyfish - Aurelia aurita
  10. ^ Gilbertson, L. 1999. Zoology Laboratory Manual 4th edition. McGraw-Hill Inc, CA, 9.2-9.7
  11. ^ Strand, S.W. and W.M. Hamner, 1988. Predatory behavior of Phacellophora camtschatica and size-selective predation upon Aurelia aurita (Scyphozoa: Cnidaria) in Saanich Inlet, British Columbia. Marine Biology, 99: 409-414 doi:10.1007/BF02112134
  12. ^ Towanda, T. and E.V. Thuesen. 2006. Ectosymbiotic behavior of Cancer gracilis and its trophic relationships with its host Phacellophora camtschatica and the parasitoid Hyperia medusarum. Marine Ecology Progress Series 315, 221-236
  13. ^ Mills, C.E. 1993. Natural mortality in NE Pacific coastal hydromedusae: grazing predation, wound healing and senescence. Bulletin of Marine Science, 53: 194-203. (Proceedings of the Zooplankton Ecology Symposium)

Further reading

  • Moen, F.E. and E. Svensen. 2004. Marine fish & invertebrates of Northern Europe. AquaPress: Southend-on-Sea. ISBN 0-9544060-2-8. 608 pp.
  • National Center for Biotechnology Information. October 23, 2001. [1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!