Overview
Comprehensive Description
Color: white, brown to orange stripes; 24-32 long orange-red tentacles; 4 long curtain-like lips; 8 marginal rhophilia (sense organ), spaced between 32 lappets; 16 dark brown/black radiating streaks on subumbrella between 8 stomach pouches; tentacles can produce a nasty sting to humans
Trusted
Distribution
Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, Indo-Pacific, North East Pacific, North Pacific
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Shih, C.T., A.J.G. Figueira & E.H. Grainger, 1971. A synopsis of Canadian marine zooplankton. Bull. Fish. Res. Bd Can. 176 : 1-264.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=31636
Trusted
Ecology
Habitat
Depth range based on 45 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.
Environmental ranges
Depth range (m): 1 - 882
Temperature range (°C): 2.696 - 4.148
Nitrate (umol/L): 9.214 - 43.662
Salinity (PPS): 32.058 - 34.295
Oxygen (ml/l): 0.552 - 7.464
Phosphate (umol/l): 1.172 - 3.203
Silicate (umol/l): 23.594 - 144.279
Graphical representation
Depth range (m): 1 - 882
Temperature range (°C): 2.696 - 4.148
Nitrate (umol/L): 9.214 - 43.662
Salinity (PPS): 32.058 - 34.295
Oxygen (ml/l): 0.552 - 7.464
Phosphate (umol/l): 1.172 - 3.203
Silicate (umol/l): 23.594 - 144.279
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 39 samples.
Environmental ranges
Depth range (m): 1 - 882
Temperature range (°C): 2.696 - 4.148
Nitrate (umol/L): 9.214 - 43.662
Salinity (PPS): 32.058 - 34.295
Oxygen (ml/l): 0.552 - 7.464
Phosphate (umol/l): 1.172 - 3.203
Silicate (umol/l): 23.594 - 144.279
Graphical representation
Depth range (m): 1 - 882
Temperature range (°C): 2.696 - 4.148
Nitrate (umol/L): 9.214 - 43.662
Salinity (PPS): 32.058 - 34.295
Oxygen (ml/l): 0.552 - 7.464
Phosphate (umol/l): 1.172 - 3.203
Silicate (umol/l): 23.594 - 144.279
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Epiplegic (surface waters) to ~100 m depth; Nertic (shelves) and over basins; Commonly observed by divers or ROVs, its abundance to and size make it rare to capture in plankton nets; Benthic form has not been observed in the Arctic, suggesting the species may be seasonally imported from the subarctic
Trusted
Trophic Strategy
Diet includes copepods, larvaceans, other jellies, larger zooplankton and small fish
Trusted
Life History and Behavior
Life Cycle
An obligate benthic phase, that strobulates (buds) to release ephra larvae; larvae mature into adult body-form that releases eggs and sperm; Fertilized eggs settle to seafloor to prooduce a small non-colonial benthic form; Life span in Arctic unknown, possibly only one season
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Chrysaora melanaster
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TATAATGTTATAGTAACAGCCCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTATTGATTGGGGGTTTCGGAAATTGGTTTGTCCCACTA---TATATTGGAAGTCCGGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGCTGAACCATTTACCCTCCTCTATCTTCTATACAATTTCATTCTGGGGGATCAGTAGATATG---GCAATATTTAGCTTACATTTAGCAGGTGCCTCTTCCATAATGGGAGCCATAAATTTTATAACAACAATTTTTAATATGAGAGCCCCAGGTATGTCAATGGATAGATTGCCTTTATTTGTATGATCAGTACTAGTAACAGCCATTCTTTTACTATTATCACTACCTGTGTTAGCCGGG---GCGATTACAATGTTATTAACAGATAGGAATTTTAATCCCTCTTTTTTTGATCCTGCAGGCGGAGGAGACCCAATTTTGTTTCAACACTTATTTTGGTTTTTTGGTCACCCTGAAGTTTATATA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Chrysaora melanaster
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Wikipedia
Chrysaora melanaster
The Japanese sea nettle (Chrysaora melanaster), also called a northern sea nettle or brown jellyfish, is a species of jellyfish native to the eastern Pacific Ocean. It is sometimes referred to as a Pacific sea nettle, but this name is also used for Chrysaora fuscescens.
| This cnidarian-related article is a stub. You can help Wikipedia by expanding it. |
| Wikimedia Commons has media related to: Chrysaora melanaster |
| Wikispecies has information related to: Chrysaora melanaster |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


