Overview

Comprehensive Description

Biology

The largest jellyfish of the Arctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Color: white, brown to orange stripes; 24-32 long orange-red tentacles; 4 long curtain-like lips; 8 marginal rhophilia (sense organ), spaced between 32 lappets; 16 dark brown/black radiating streaks on subumbrella between 8 stomach pouches; tentacles can produce a nasty sting to humans
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, Indo-Pacific, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 45 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 1 - 882
  Temperature range (°C): 2.696 - 4.148
  Nitrate (umol/L): 9.214 - 43.662
  Salinity (PPS): 32.058 - 34.295
  Oxygen (ml/l): 0.552 - 7.464
  Phosphate (umol/l): 1.172 - 3.203
  Silicate (umol/l): 23.594 - 144.279

Graphical representation

Depth range (m): 1 - 882

Temperature range (°C): 2.696 - 4.148

Nitrate (umol/L): 9.214 - 43.662

Salinity (PPS): 32.058 - 34.295

Oxygen (ml/l): 0.552 - 7.464

Phosphate (umol/l): 1.172 - 3.203

Silicate (umol/l): 23.594 - 144.279
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epiplegic (surface waters) to ~100 m depth; Nertic (shelves) and over basins; Commonly observed by divers or ROVs, its abundance to and size make it rare to capture in plankton nets; Benthic form has not been observed in the Arctic, suggesting the species may be seasonally imported from the subarctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Diet includes copepods, larvaceans, other jellies, larger zooplankton and small fish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

An obligate benthic phase, that strobulates (buds) to release ephra larvae; larvae mature into adult body-form that releases eggs and sperm; Fertilized eggs settle to seafloor to prooduce a small non-colonial benthic form; Life span in Arctic unknown, possibly only one season
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysaora melanaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATAATGTTATAGTAACAGCCCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTATTGATTGGGGGTTTCGGAAATTGGTTTGTCCCACTA---TATATTGGAAGTCCGGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGCTGAACCATTTACCCTCCTCTATCTTCTATACAATTTCATTCTGGGGGATCAGTAGATATG---GCAATATTTAGCTTACATTTAGCAGGTGCCTCTTCCATAATGGGAGCCATAAATTTTATAACAACAATTTTTAATATGAGAGCCCCAGGTATGTCAATGGATAGATTGCCTTTATTTGTATGATCAGTACTAGTAACAGCCATTCTTTTACTATTATCACTACCTGTGTTAGCCGGG---GCGATTACAATGTTATTAACAGATAGGAATTTTAATCCCTCTTTTTTTGATCCTGCAGGCGGAGGAGACCCAATTTTGTTTCAACACTTATTTTGGTTTTTTGGTCACCCTGAAGTTTATATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysaora melanaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysaora melanaster

The Japanese sea nettle (Chrysaora melanaster), also called a northern sea nettle or brown jellyfish, is a species of jellyfish native to the eastern Pacific Ocean. It is sometimes referred to as a Pacific sea nettle, but this name is also used for Chrysaora fuscescens.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!