Overview

Brief Summary

Biology

colonial
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A colonial hydroid comprising erect, slightly zigzag but slender main stems that grow up to about 15 cm. The lateral branches tend to be in pairs, successively on opposite sides of the stem. The minor branches are delicate. The hydrothecae, a supporting, nonliving, protein-chitinous envelope surrounding the stem, is elongate and bell-shaped.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range covers both subprovinces of Acadian and Virginian.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-global
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Obelia corona Torrey, 1904
Catalog Number: USNM 43608
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1904
Locality: San Diego Bay, California, United States, North Pacific Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Obelia bicuspidata Clarke, 1875
Catalog Number: USNM 29082
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1874
Locality: The Thimbles, Connecticut, United States, North Atlantic Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Obelia bidentata Clarke, 1875
Catalog Number: USNM 72361
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Year Collected: 1874
Locality: Long Island, Greenport, New York, United States, North Atlantic Ocean
  • Syntype: Clark, S. F. 1875. Trans. Conn. Acad. Arts Sci. 3: 58, pl. 9, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Obelia bidentata Clarke, 1875
Catalog Number: USNM 28923
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1874
Locality: Long Island, Off Greenport, New York, United States, North Atlantic Ocean
  • Syntype: Clark, S. F. 1875. Trans. Conn. Acad. Arts Sci. 3: 58, pl. 9, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Obelia bidentata Clarke, 1875
Catalog Number: USNM 29233
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1874
Locality: Long Island, Off Greenport, New York, United States, North Atlantic Ocean
  • Syntype: Clark, S. F. 1875. Trans. Conn. Acad. Arts Sci. 3: 58, pl. 9, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 199 - 199
  Temperature range (°C): 1.332 - 1.332
  Nitrate (umol/L): 33.800 - 33.800
  Salinity (PPS): 34.260 - 34.260
  Oxygen (ml/l): 5.677 - 5.677
  Phosphate (umol/l): 2.208 - 2.208
  Silicate (umol/l): 57.652 - 57.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0 - 4436
  Temperature range (°C): -1.304 - 24.233
  Nitrate (umol/L): 2.736 - 33.540
  Salinity (PPS): 34.096 - 36.149
  Oxygen (ml/l): 3.117 - 7.101
  Phosphate (umol/l): 0.169 - 2.406
  Silicate (umol/l): 2.001 - 92.306

Graphical representation

Depth range (m): 0 - 4436

Temperature range (°C): -1.304 - 24.233

Nitrate (umol/L): 2.736 - 33.540

Salinity (PPS): 34.096 - 36.149

Oxygen (ml/l): 3.117 - 7.101

Phosphate (umol/l): 0.169 - 2.406

Silicate (umol/l): 2.001 - 92.306
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on inert substrata such as wood, shells, wrecks and on sandy bottoms, sometimes algae. Tolerant of brackish water, sublittoral to at least 200 m, rarely intertidal in pools. Also stranded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Obelia bidentata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTGTACTTAGTTTTCGGAGCTTTTTCAGGAATGGTAGGTACAGCTTTAAGTATGTTAATTAGGTTAGAACTAGCTGGTCCAGGAGCTATGTTCGGTGAT---GATCATTTATATAATGTAATTGTTACTGCTCATGCATTTGTAATGATCTTTTTTTTAGTCATGCCAGTATTAATTGGAGGATTTGGAAATTGATTAATACCTTTATATATTGGAGCCCCTGATATGGCTTTTCCAAGACTAAATAATTTAAGTTTTTGATTATTACCTCCTGCATTATTATTATTATTAGGATCCTCTTTAGTTGAACAAGGAGCAGGTACAGGATGAACAGTATATCCTCCTTTAGCAGGACCTCAAACTCATTCAGGGGGTTCCGTTGATATGGCAATTTTTAGTTTACATTGTGCAGGTGCATCATCAATTATGGGGGCAATAAATTTTATTACTACTATATTTAATATGAGAGCACCAGGGATGACTTTAGATAAATTACCATTATTTGTGTGATCAGTATTAATTACTGCATTTTTATTATTATTATCTCTACCAGTATTAGCAGGAGCAATAACTATGTTACTAACCGATAGAAATTTTAATACAACCTTTTTTGATCCAGCAGGGGGAGGTGATCCTGTATTATATCAACATTTATTTTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Obelia bidentata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!