Overview
Brief Summary
Biology
calcareous colonies, no free medusae
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Distribution
East Pacific
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Physical Description
Type Information
Syntype for Allopora californica Verrill, 1866
Catalog Number: USNM 43280
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): W. Rich
Locality: California, United States
Catalog Number: USNM 43280
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): W. Rich
Locality: California, United States
- Syntype: Verrill. 1866. Proc. Comm. Essex Inst. 5: 37-38, no figs.
Trusted
Ecology
Habitat
Depth range based on 1 specimen in 1 taxon.
Environmental ranges
Depth range (m): 23 - 23
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 23 - 23
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Stylaster californicus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGTAGGTACAGCATTAAGTATGTTAATAAGATTAGAACTAGCTGCTCCCGGAACTATGTTCGGTAATGATCACTTATATAATGTTATAGTAACAGCACACGCTTTTGTAATGATATTTTTCCTAGTAATGCCAGTATTAATAGGGGGTTATGGAAATTGGTTTGTTCCACTATACATTGGAGCACCTGACATGGCTTTTCCCAGACTAAATAATTTAAGCTTTTGATTACTCCCCCCGGCTCTAATGTTATTAATAGGGTCTTCTCTAATTGAACAAGGTGCTGGTACAGGGTGAACTGTTTACCCTCCTCTATCAGGACCACTAACACATTCTGGGGGGTCTGTAGATTTAGCAATATTTAGTTTACATTGTGCAGGAGCTTCTTCAATTATGGGGGCTATTAACTTTATTACAACTATAATCAATATGAGAGCTCCAGGCTTAACAATGGATAAACTCCCATTATTTATATGAGCTGTTCTAATAACAGCCATTTTATTACTTCTATCATTACCAGTACTAGCTGGTGCAATAACCATGCTACTAACTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Stylaster californicus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Trusted
Genomic DNA is available from 14 specimens with morphological vouchers housed at Queensland Museum
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

