Overview

Brief Summary

Biology

calcareous colonies, no free medusae
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Allopora californica Verrill, 1866
Catalog Number: USNM 43280
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): W. Rich
Locality: California, United States
  • Syntype: Verrill. 1866. Proc. Comm. Essex Inst. 5: 37-38, no figs.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 23 - 23
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stylaster californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTAGGTACAGCATTAAGTATGTTAATAAGATTAGAACTAGCTGCTCCCGGAACTATGTTCGGTAATGATCACTTATATAATGTTATAGTAACAGCACACGCTTTTGTAATGATATTTTTCCTAGTAATGCCAGTATTAATAGGGGGTTATGGAAATTGGTTTGTTCCACTATACATTGGAGCACCTGACATGGCTTTTCCCAGACTAAATAATTTAAGCTTTTGATTACTCCCCCCGGCTCTAATGTTATTAATAGGGTCTTCTCTAATTGAACAAGGTGCTGGTACAGGGTGAACTGTTTACCCTCCTCTATCAGGACCACTAACACATTCTGGGGGGTCTGTAGATTTAGCAATATTTAGTTTACATTGTGCAGGAGCTTCTTCAATTATGGGGGCTATTAACTTTATTACAACTATAATCAATATGAGAGCTCCAGGCTTAACAATGGATAAACTCCCATTATTTATATGAGCTGTTCTAATAACAGCCATTTTATTACTTCTATCATTACCAGTACTAGCTGGTGCAATAACCATGCTACTAACTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stylaster californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 14 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!