Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, den Hartog, and Arneson, 1986 YES MINERAL ARAGONITE
Verrill, 1905 YES MINERAL ARAGONITE
Verrill, 1901 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Caribbean, the southern Gulf of Mexico, Florida, the Bahamas, and Bermuda. It is also known from the eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles, Panama and Bermuda.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.0 of 5

Ecology

Habitat

rocks (Kalk, 1959).
  • Kalk, M. (1959). A general ecological survey of some shores in northern Mozambique. Revta Biol., Lisb. 2: 1-24.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
P. porites is found on most reef environments, from 0.5 to 35 m depth, and also exists in back reef shallow platforms with Thalassia turtle grass beds and attached to mangrove prop roots; this species is most common from 1-15 m (Weil 1992b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Depth range from 0.5-34 m, but typically occurs between 2-6 m on most classes of reef communities.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3707 specimens in 8 taxa.
Water temperature and chemistry ranges based on 2774 samples.

Environmental ranges
  Depth range (m): -0.5 - 92
  Temperature range (°C): 19.819 - 28.067
  Nitrate (umol/L): 0.090 - 8.028
  Salinity (PPS): 34.667 - 36.787
  Oxygen (ml/l): 3.986 - 4.889
  Phosphate (umol/l): 0.020 - 0.379
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): -0.5 - 92

Temperature range (°C): 19.819 - 28.067

Nitrate (umol/L): 0.090 - 8.028

Salinity (PPS): 34.667 - 36.787

Oxygen (ml/l): 3.986 - 4.889

Phosphate (umol/l): 0.020 - 0.379

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Occurs on many classes of seagrass communities as well as reef areas, including patch reefs, fringing reefs, spur and groove reefs and deeper intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A84PET01FCUS: protozoan parasites. A90GHI01FCUS, A90WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. Resistant to sedimentation (see A76BAK02FCUS). A81MAR00FCUS: optimal temperature range (22-32 degrees) and (16-20 degrees). Salinity tolerance below 40 ppt and above 15 ppt. A72OTT01FCUS: preyed upon by Hermodice caruncullata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

A82HIG01FCUS, A85HUG02FCUS: extensive reproduction via fragmentation. A85HAR01FCUS, A86SZM00FCUS, A83FAD00FCUS: hermaphroditic brooder with swimming planula one week after release. A81GOR01FCUS: no relation between planula release and lunar phase. A87TOM02FCUS: but species reported to be gonochoric with hermaphroditism limited to colonies on eutrophicated reefs. A91TOM02FCUS: high reported recruitment rates on shallow-water reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porites porites

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCGCTGGGCGTTTTCTACTAACCATAAAGACATTGGTACGTTATATTTAGTATTTGGGATTGGGGCAGGTATGCTCGGTACAGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACAGCACACGCTTTTATTATGATCTTTTTTTTGGTTATGCCAGTAATGATAGGGGGATTTGGGAATTGGTTGGTTCCATTATATATTGGGGCGCCTGATATGGCTTTTCCACGGCTTAATAACATTAGTTTTTGGCTGTTACCCCCTGCTTTAATATTGTTATTAGGTTCTGCTTTTGTCGAACAAGGAGCGGGTACCGGATGAACGGTTTATCCTCCTCTATCTAGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGAGGGCCCCTGGGCTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCAATCTTGATCACTGCTTTTTTATTATTATTGTCTTTGCCCGTATTAGCGGGGGCCATAACCATGCTTTTAACGGATAGAAACTTTAATACTACTTTCTTTGATCCCGCAGGGGGGGGAGATCCGATTTTATTTCAACATTTGTTTTGGTTCTTTGGGCATCCTGAAGTTTATATTTTAATATTACCTGGCTTTGGAATGATTTCTCAAATAATACCAACTTTTGTTGCTAAAAAGCAAATTTTTGGATACTTAGGTATGGTTTATGCAATGCTTTCAATTGGTATTTTAGGTTTTATTGTGTGGGCCCATCATATGTTTACGGTTGGGATGGATGTGGACACAAGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Porites porites

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). This species is widespread and common within its range, can be found in a number of different habitats, and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Not considered threatened due to a widespread distribution in the tropical western Atlantic and occurrence on many classes of marine hardbottom and soft sediment communities. Characterized by moderate sensitivity to eutrophication, salinity and temperature fluctuations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is the most common of the branching Porites corals in the Caribbean. Several places in shallow-water back reef and some shallow (above 10 m) fore reef environments that used to have very large stands have experienced extensive mortality (e.g., Mona Island and the south coast of Puerto Rico, Grenada, Morrocoy NP in Venezuela (Glynn 1973, E. Weil & A Bruckner pers. comm.)), although smaller colonies still occur in these areas.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Data from southern Florida indicate population stability but information needed from the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Shallow-water populations are susceptible to typical threats such as pollution, burial by sediment, hurricane damage, and predation by Sparisoma viride (Stoplight Parrotfish), and loss of habitat due to coastal development, dredging, and beach renourishment, which have caused localized declines.

The genus is not particularly susceptible to bleaching, but is more prone to disease than many other corals. Coral disease has emerged as a serious threat to coral reefs worldwide and is a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the Great Barrier Reef were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification. In addition to global climate change, corals are also threatened by a number of localized threats. Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities. The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Moderate salinity and temperature tolerance range but low sensitivity to sedimentation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All corals are listed on CITES Appendix II. In US waters, it is illegal to harvest corals for commercial purposes. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

Parts of this species distribution fall within several Marine Protected Areas within its range. In the US, it is present in many Marine Protected Areas, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, and Buck Island Reef National Monument. Its presence in the Flower Garden Banks National Marine Sanctuary requires verification. Also present in Hol Chan Marine Reserve in Belize, and Exuma Cays Land and Sea Park in the Bahamas.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., Marine Protected Areas, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data needed on incidence of bleaching and susceptibility to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous populations in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys should be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Porites porites

Porites porites, commonly known as hump coral or finger coral, is a species of stony coral in the genus Porites. It is found in the Caribbean Sea and western Atlantic Ocean and also along the coast of West Africa.

Contents

Description

Porites porites forms irregular patches of short, finger-like lobes with blunt, slightly swollen tips. Sometimes these are densely packed but in other locations they are widely spaced. The lobes are up to 2.5 cm (1 in) wide which distinguishes this species from other members of the genus that have narrower lobes. They may be curved or hooked and grow in all directions. The colour is usually white or pale blueish-grey.[2][3]

Distribution and habitat

Porites porites occurs throughout the Gulf of Mexico, the Caribbean Sea, the Bahamas and southern Florida and as far south as Venezuela.[1] It is also found in shallow tropical seas off the west coast of Africa.[4] It is found from low water mark down to a depth of about 20 metres (66 ft) and occurs on both fore reefs and back reefs where the water is not too turbid.[2] It also occurs on the prop roots of mangroves and among seagrass {Thalassia spp.).[4]

Biology

Porites porites is a zooxanthellate coral, the tissues containing unicellular green algae living symbiotically within the cells.[1] These are photosynthetic and use the carbon dioxide and waste materials produced by the coral, supplying oxygen and organic compounds in return. Unlike most stony corals, the polyps of Porites porites often extend their tentacles to feed in the daytime.[2]

Status

Porites porites is listed as being of "Least Concern" in the IUCN Red List of Threatened Species. This is because it is a common species throughout its range and the population seems stable. It is an adaptable species being found in a wide range of habitats and is not particularly susceptible to bleaching. It is prone to coral diseases but its chief threat is the loss of reef habitat through mechanical damage, violent storms, a rise in sea temperatures, ocean acidification, pollution, increased sedimentation and tourism.[4]

References

  1. ^ a b c van der Land, Jacob (2012). "Porites porites Pallas". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=207238. Retrieved 2012-11-05.
  2. ^ a b c Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 239. ISBN 0-86622-875-6. 
  3. ^ "Porites porites (Pallas 1766)". Coralpedia. http://coralpedia.bio.warwick.ac.uk/en/corals/porites_porites.html. Retrieved 2012-11-05.
  4. ^ a b c Aronson, R.; Bruckner, A.; Moore, J.; Precht, B.; Weil, E. (2008). "Porites porites". IUCN Red List of Threatened Species. Version 2012.2. http://www.iucnredlist.org/details/133395/0. Retrieved 2012-11-05.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Zlatarski and Estalella (1982) give 'forma typica' status to this subspecies of P. porites. P. porites and the other branching Caribbean subspecies are currently being studied by several researchers to determine their status. This is the nominate species for a group of subspecies, so its full name is P. porites porites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!