Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Verrill, 1901 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Rathbun, 1887 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, and the Bahamas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in shallow to mid-slope reef environments, and sometimes in shallow seagrass habitats. On the south coast of Puerto Rico, occurs from 0.2-50 m, and is most abundant from 1-15 m (Goreau and Wells 1967, Weil 1992b). This species may be the dominant coral on the reef flat forming monospecific stands; colonies form a dense framework at 0.5-1.5 m depth, immediately behind the Millepora dominated reef crest and extending into the back reef (Goreau 1959, Glynn 1973).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 518 specimens in 3 taxa.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): 0 - 22
  Temperature range (°C): 26.412 - 27.998
  Nitrate (umol/L): 0.024 - 2.416
  Salinity (PPS): 35.075 - 36.546
  Oxygen (ml/l): 4.330 - 4.661
  Phosphate (umol/l): 0.047 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 22

Temperature range (°C): 26.412 - 27.998

Nitrate (umol/L): 0.024 - 2.416

Salinity (PPS): 35.075 - 36.546

Oxygen (ml/l): 4.330 - 4.661

Phosphate (umol/l): 0.047 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porites furcata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGTTATATTTAGTATTTGGGATTGGGGCAGGTATGCTCGGTACAGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACAGCACACGCTTTTATTATGATCTTTTTTTTGGTTATGCCAGTAATGATAGGGGGATTTGGGAATTGGTTGGTTCCATTATATATTGGGGCGCCTGATATGGCTTTTCCACGGCTTAATAACATTAGTTTTTGGCTGTTACCCCCTGCTTTAATATTGTTATTAGGTTCTGCTTTTGTCGAACAAGGAGCGGGTACCGGATGAACGGTTTATCCTCCTCTATCTAGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGAGGGCCCCTGGGCTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCAATCTTGATCACTGCTTTTTTATTATTATTGTCTTTGCCCGTATTAGCGGGGGCCATAACCATGCTTTTAACGGATAGAAACTTTAATACTACTTTCTTTGATCCCGCAGGGGGGGGAGATCCGATTTTATTTCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Porites furcata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread and common throughout its range, can be found outside of reef habitat and in deeper waters, and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is fairly common throughout the range.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Shallow-water populations of this species are susceptible to typical threats such as pollution, bleaching, burial by sediment, hurricane damage, and loss of habitat due to coastal development, dredging, and beach renourishment, which may cause localized declines.

The genus is not particularly susceptible to bleaching, but is more prone to disease than many other corals. Coral disease has emerged as a serious threat to coral reefs worldwide and is a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the Great Barrier Reef were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification. In addition to global climate change, corals are also threatened by a number of localized threats. Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities. The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All corals are listed on CITES Appendix II. Parts of this species distribution fall within several Marine Protected Areas within its range.In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., Marine Protected Areas, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Porites furcata

Porites furcata, commonly known as hump coral, thin finger coral or branched finger coral, is a species of stony coral in the genus Porites. It is found in the Caribbean Sea and western Atlantic Ocean.

Description[edit]

Porites furcata is a colonial coral forming clumps of short, slender lobes with rounded tips, often densely packed together. It sometimes forms extensive patches several square metres (yards) in area. The colour of this coral is yellow or pale brown and the lobes grow to a diameter of 1 to 2 cm (0.4 to 0.8 in). The interior parts of the coral often have a purplish tinge and are dead, perhaps killed off by the increased shading and lack of water circulation caused by newer growth above. This species is intermediate in appearance between Porites porites which has branches 2.5 cm (1 in) wide and Porites divaricata, the branches of which are under 1 cm (0.4 in) wide.[2][3]

Distribution and habitat[edit]

Porites furcata is found in the Caribbean Sea, the Gulf of Mexico, the Bahamas and southern Florida from low water mark down to depths of about 20 metres (66 ft). It has not been found in Bermuda.[2] Its preferred habitat is back reefs but it also occurs in other parts of the reef.[4] In areas where this species is common, the dead, basal parts of the coral are responsible for most of the coral rubble on the reef. Grooves can sometimes be seen cutting across the colonies of this species. These are caused by heavy detached chunks of massive coral being moved across the reef during severe storms.[2] Fossils of this species have been found in Florida dating back to the Pleistocene.[2]

Ecology[edit]

Porites furcata is a zooxanthellate coral,[1] the tissues containing unicellular green algae living symbiotically within the cells. These are photosynthetic and use the carbon dioxide and waste products of the coral while at the same time supplying oxygen and organic compounds to their host.[5] The polyps are often extended during the day.[4]

The niches and crevices in this coral are home to a range of invertebrates and other organisms including brittle stars, sea urchins, polychaete worms, chitons and algae.[2]

Status[edit]

Porites furcata is listed as being of "Least Concern" in the IUCN Red List of Threatened Species. This is because it is a common species throughout its range and the population seems stable. It is a fairly adaptable species being found in a range of habitats but it is particularly susceptible to bleaching. Its chief threat is the loss of reef habitat through mechanical damage, violent storms, a rise in sea temperatures, ocean acidification, pollution, increased sedimentation and tourism.[6]

References[edit]

  1. ^ a b van der Land, Jacob (2012). "Porites furcata Lamarck, 1816". World Register of Marine Species. Retrieved 2012-11-06. 
  2. ^ a b c d e Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 238–239. ISBN 0-86622-875-6. 
  3. ^ "Porites furcat Lamarck 1816". Coralpedia. Retrieved 2012-11-06. 
  4. ^ a b "Thin finger coral (Porites furcata)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. Retrieved 2012-11-06. 
  5. ^ Dorit, R. L.; Walker, W. F.; Barnes, R. D. (1991). Zoology. Saunders College Publishing. p. 612. ISBN 0-03-030504-7. 
  6. ^ Aronson, R.; Bruckner, A.; Moore, J.; Precht, B.; Weil, E. (2008). "Porites furcata". IUCN Red List of Threatened Species. Version 2012.2. Retrieved 2012-11-06. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!