Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Utinomi, 1965 YES MINERAL ARAGONITE
Wells, 1961 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

In the Indo-West Pacific, this species is found in the Red Sea and Gulf of Aden, southwest and northwest Indian Ocean & Arabian/Iranian Gulf, Northern Indian Ocean, Central Indo-Pacific, Australia, Southeast Asia, Japan and East China Sea, Oceanic West Pacific, Central Pacific. This species is found in Palau (Randall 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

This is a fully meandroid species. The series have unperforated, broad walls, which are broader than the valley floor. Septa are regular, and are all equal in size, or nearly so. The valley floor in most specimens from the Arabian region Sea is flat, smooth and solid. Septa emerge from this solid floor. In parts of the coralla, trabecular elements emerge from these to form the kind of columella usually associated with all species of the genus. This valley floor is distinctly different to those of P. lamellina seen from further east, which are more typical of the genus. Platygyra lamellina is not common, though it is widespread. It prefers shallow water on fore-reef slopes and, because it forms large colonies, it is usually conspicuous. (Sheppard, 1998 <308>) Colonies are massive, meandroid, with thick walls. Septa are uniformly exsert and are neat and rounded. Colour: usually brown or with brown walls and grey or green valleys. Abundance: usually uncommon. (Veron, 1986 <57>)
  • Veron, J.E.N. (1986). Corals of Australia and the Indo-Pacific. Angus & Robertson Publishers, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in most tropical reef environments, especially back reef margins. This species is found on the back and foreslope of the reef and in lagoons.

Platygyra species occupy a variety of reef habitats. They may form colonies a meter or more in diameter (Wood 1983).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 190 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0 - 47
  Temperature range (°C): 22.214 - 28.472
  Nitrate (umol/L): 0.046 - 0.946
  Salinity (PPS): 33.101 - 35.521
  Oxygen (ml/l): 4.536 - 4.969
  Phosphate (umol/l): 0.081 - 0.312
  Silicate (umol/l): 0.900 - 3.925

Graphical representation

Depth range (m): 0 - 47

Temperature range (°C): 22.214 - 28.472

Nitrate (umol/L): 0.046 - 0.946

Salinity (PPS): 33.101 - 35.521

Oxygen (ml/l): 4.536 - 4.969

Phosphate (umol/l): 0.081 - 0.312

Silicate (umol/l): 0.900 - 3.925
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Platygyra lamellina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTTTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGAGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Platygyra lamellina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
DeVantier, L., Hodgson, G., Huang, D., Johan, O., Licuanan, A., Obura, D., Sheppard, C., Syahrir, M. & Turak, E.

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats, however, this species is also moderately susceptible to bleaching and disease. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread and uncommon throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 20% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category. However, since this population reduction estimate is close to a threatened threshold, and because this species is moderately susceptible to a number of threats, it is likely to be one of the species lost on some reefs currently at the critical stage of degradation and therefore is Near Threatened. Predicted threats from climate change and ocean acidification make it important to reassess this species in 10 years or sooner, particularly if the species is actually observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is usually uncommon, but can be common in places.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined globally.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats are global warming and predation. The bleaching of coral reefs, which has become increasingly frequent since the 1970s, is related to the ongoing rise in ocean in temperatures as a result of global climate change. Bleaching events, leading to coral mortality, are predicted to become more frequent and severe.

Other more localised threats include coral removal and harvesting, disturbance by fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, storms, and human recreation and tourism activities.

It is exported from Fiji (Hodgson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II and is present in some marine protected areas.

Recommended measures for conserving this species include research in taxonomy, population, biology and ecology of the species, habitat status, threats, uses, harvest levels, conservation measures, and trends; training in conservation measures; conservation of the habitat; restoration actions; identification, establishment and management of new protected areas; expansion of protected areas; and recovery management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!