Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Colonies are massive with round corallites of varying sizes. Calices are shallow, approximately 6-13 mm in diameter, with tightly compacted septa. Columellae are large and small paliform lobes are usually developed. Colour: Very variable but usually several colours, including grey, green, orange and pink, are arranged concentrically to the corallites. Abundance: usually uncommon, found on protected reef slopes. (Veron, 1986 <57>)
  • Veron, J.E.N., Pichon, M. & Wijsman-Best, M. 1977. Scleractinia of Eastern Australia – Part II. Families Faviidae, Trachyphylliidae. Australian Institute of Marine Science Monograph series 3: 1–233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 105 specimens in 1 taxon.
Water temperature and chemistry ranges based on 45 samples.

Environmental ranges
  Depth range (m): 0 - 13
  Temperature range (°C): 22.214 - 27.427
  Nitrate (umol/L): 0.064 - 0.923
  Salinity (PPS): 34.822 - 35.521
  Oxygen (ml/l): 4.567 - 4.954
  Phosphate (umol/l): 0.081 - 0.187
  Silicate (umol/l): 0.900 - 3.620

Graphical representation

Depth range (m): 0 - 13

Temperature range (°C): 22.214 - 27.427

Nitrate (umol/L): 0.064 - 0.923

Salinity (PPS): 34.822 - 35.521

Oxygen (ml/l): 4.567 - 4.954

Phosphate (umol/l): 0.081 - 0.187

Silicate (umol/l): 0.900 - 3.620
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Montastraea magnistellata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGACCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGAGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Montastraea magnistellata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!