Overview
Brief Summary
Biology
zooxanthellate
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Comprehensive Description
Biology: Skeleton
More info
| Author | Skeleton? | Mineral or Organic? | Mineral | Percent Magnesium |
|---|---|---|---|---|
| Cairns, Hoeksema, and van der Land, 1999 | YES | MINERAL | ARAGONITE |
Trusted
Distribution
Indo-West Pacific, Red Sea, Seychelles
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Sheppard, C.R.C. (1998). Corals of the Indian Ocean: a taxonomic and distribution database for coral reef ecologists
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6092
-
Best, W.G., G. Faure & M. Pichon (1980). Contribution to the knowledge of the stony corals from the Seychelles and Eastern Africa. Rev. Zool. Afr. 94,3: 600 - 627.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6043
-
Sheppard, C.R.C (1987). [Best et al, boshof]
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5902
Trusted
Physical Description
Diagnostic Description
Description
Colonies are massive with round corallites of varying sizes. Calices are shallow, approximately 6-13 mm in diameter, with tightly compacted septa. Columellae are large and small paliform lobes are usually developed. Colour: Very variable but usually several colours, including grey, green, orange and pink, are arranged concentrically to the corallites. Abundance: usually uncommon, found on protected reef slopes. (Veron, 1986 <57>)
-
Veron, J.E.N., M. Pichon & M. Wijsman-Best (1977). Scleractinia of Eastern Australia. Part II. Families Faviidae, Trachyphyllidae. Australian Institute of Marine Science Monograph Series. Volume 3.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5913
Trusted
Ecology
Habitat
Depth range based on 105 specimens in 1 taxon.
Water temperature and chemistry ranges based on 45 samples.
Environmental ranges
Depth range (m): 0 - 13
Temperature range (°C): 22.214 - 27.427
Nitrate (umol/L): 0.064 - 0.923
Salinity (PPS): 34.822 - 35.521
Oxygen (ml/l): 4.567 - 4.954
Phosphate (umol/l): 0.081 - 0.187
Silicate (umol/l): 0.900 - 3.620
Graphical representation
Depth range (m): 0 - 13
Temperature range (°C): 22.214 - 27.427
Nitrate (umol/L): 0.064 - 0.923
Salinity (PPS): 34.822 - 35.521
Oxygen (ml/l): 4.567 - 4.954
Phosphate (umol/l): 0.081 - 0.187
Silicate (umol/l): 0.900 - 3.620
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 45 samples.
Environmental ranges
Depth range (m): 0 - 13
Temperature range (°C): 22.214 - 27.427
Nitrate (umol/L): 0.064 - 0.923
Salinity (PPS): 34.822 - 35.521
Oxygen (ml/l): 4.567 - 4.954
Phosphate (umol/l): 0.081 - 0.187
Silicate (umol/l): 0.900 - 3.620
Graphical representation
Depth range (m): 0 - 13
Temperature range (°C): 22.214 - 27.427
Nitrate (umol/L): 0.064 - 0.923
Salinity (PPS): 34.822 - 35.521
Oxygen (ml/l): 4.567 - 4.954
Phosphate (umol/l): 0.081 - 0.187
Silicate (umol/l): 0.900 - 3.620
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Montastraea magnistellata
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACTGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGACCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGAGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Montastraea magnistellata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

