Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Bermuda, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico, Venezuela, West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a common species. M. franksi is found from 5-50 m, and is often the most abundant coral from 15-30 m in fore-reef environments (Weil and Knowlton 1994, Szmant et al. 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2561 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2163 samples.

Environmental ranges
  Depth range (m): 0.3 - 109.375
  Temperature range (°C): 19.819 - 28.067
  Nitrate (umol/L): 0.115 - 8.028
  Salinity (PPS): 35.091 - 36.556
  Oxygen (ml/l): 3.986 - 4.773
  Phosphate (umol/l): 0.049 - 0.379
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.3 - 109.375

Temperature range (°C): 19.819 - 28.067

Nitrate (umol/L): 0.115 - 8.028

Salinity (PPS): 35.091 - 36.556

Oxygen (ml/l): 3.986 - 4.773

Phosphate (umol/l): 0.049 - 0.379

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Montastraea franksi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATCCGTTGGGTTTTCTCTACAAATCATAAAGACATAGGAACTTTATATTTAGTTTTTGGTGTTGGAGCAGGTCAAATTGGGACTGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCGATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTGATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTTTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTCTCTTTTAATAGAATGCCCTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGGGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCACCCCGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTATAATTTCTCAAATAATACCTACTTTTGTTGCTAAAAAACAAATTTTTGGGTATTTAGGGATGGTTTATGCGATGCTTTCAATTGGTCTTCTTGGGTTTATTGTTTGAGCCCATCATATGTTTACAGTTGGGATGGATGTGGACACAAGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Montastraea franksi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4ce

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is widespread and common in the Caribbean. However, this species is particularly susceptible to disease and the population has declined over the last ten years due to this. Extensive reduction of coral reef habitat due to a combination of threats has also occurred. Population reduction can be inferred from declines in habitat quality based on the combined estimates of both destroyed reefs and reefs at the critical stage of degradation within its range (Wilkinson 2004). Its threat susceptibility increases the likelihood of being lost within one generation in the future from reefs at a critical stage. Therefore, the estimated habitat degradation and loss of 38% over three generation lengths (30 years) is the best inference of population reduction and meets the threshold for Vulnerable under Criterion A4ce. It will be important to reassess this species in 10 years time because of predicted threats from climate change and ocean acidification.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the last 20 years, there has been a severe decline in the overall cover and abundance of M. annularis in several parts of the Caribbean. Declines in M. franksi appear to have taken place mainly in the past 10 years. Although this coral appears to be more resistant to disease than the other species in the complex, since 2002 in US waters, there has been an accelerating decline in cover (A. Bruckner and E. Weil pers. comm.).

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats to the species are infectious diseases (e.g., plague, yellow band and black band disease) and bleaching. Other threats include loss of habitat at the recruitment stage due to algal overgrowth and sedimentation, as well as localized impacts due to bioerosion by sponges and other organisms, and other diseases.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. In the Marine Conservation District off St Croix this species is the most abundant coral species. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. There is a need for more quantitative information on the status of the populations in deeper habitats. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!