Articles on this page are available in 1 other language: Spanish (14) (learn more)
Overview
Brief Summary
Biology
zooxanthellate
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Comprehensive Description
Biology: Skeleton
More info
| Author | Skeleton? | Mineral or Organic? | Mineral | Percent Magnesium |
|---|---|---|---|---|
| Cairns, Hoeksema, and van der Land, 1999 | YES | MINERAL | ARAGONITE |
Trusted
Distribution
Aruba, Bermuda, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico, Venezuela, West Atlantic
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Miloslavich P, Díaz JM, Klein E, Alvarado JJ, Díaz C, et al. (2010) Marine Biodiversity in the Caribbean: Regional Estimates and Distribution Patterns. PLoS ONE 5(8): e11916. doi:10.1371/journal.pone.0011916
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145466
-
Nunes FLD, Norris RD, Knowlton N. (2011). Long Distance Dispersal and Connectivity in Amphi-Atlantic Corals at Regional and Basin Scales. PLoS ONE 6(7): e22298.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=162909
-
Locke JM, Bilewitch JP and Coates KA. 2013. Scleractinia, Octocorallia and Antipatharia of Bermuda’s reefs and deep-water coral communities: a taxonomic perspective including new records. In: Sheppard C (ed.) Coral Reefs of the World Vol. 4. Coral Reefs of the UK Overseas Territories.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165132
Trusted
Range Description
This species occurs in the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
This is a common species. M. franksi is found from 5-50 m, and is often the most abundant coral from 15-30 m in fore-reef environments (Weil and Knowlton 1994, Szmant et al. 1997).
Systems
- Marine
Trusted
Depth range based on 2561 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2163 samples.
Environmental ranges
Depth range (m): 0.3 - 109.375
Temperature range (°C): 19.819 - 28.067
Nitrate (umol/L): 0.115 - 8.028
Salinity (PPS): 35.091 - 36.556
Oxygen (ml/l): 3.986 - 4.773
Phosphate (umol/l): 0.049 - 0.379
Silicate (umol/l): 0.805 - 5.080
Graphical representation
Depth range (m): 0.3 - 109.375
Temperature range (°C): 19.819 - 28.067
Nitrate (umol/L): 0.115 - 8.028
Salinity (PPS): 35.091 - 36.556
Oxygen (ml/l): 3.986 - 4.773
Phosphate (umol/l): 0.049 - 0.379
Silicate (umol/l): 0.805 - 5.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2163 samples.
Environmental ranges
Depth range (m): 0.3 - 109.375
Temperature range (°C): 19.819 - 28.067
Nitrate (umol/L): 0.115 - 8.028
Salinity (PPS): 35.091 - 36.556
Oxygen (ml/l): 3.986 - 4.773
Phosphate (umol/l): 0.049 - 0.379
Silicate (umol/l): 0.805 - 5.080
Graphical representation
Depth range (m): 0.3 - 109.375
Temperature range (°C): 19.819 - 28.067
Nitrate (umol/L): 0.115 - 8.028
Salinity (PPS): 35.091 - 36.556
Oxygen (ml/l): 3.986 - 4.773
Phosphate (umol/l): 0.049 - 0.379
Silicate (umol/l): 0.805 - 5.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Montastraea franksi
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATCCGTTGGGTTTTCTCTACAAATCATAAAGACATAGGAACTTTATATTTAGTTTTTGGTGTTGGAGCAGGTCAAATTGGGACTGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCGATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTGATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTTTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTCTCTTTTAATAGAATGCCCTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGGGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCACCCCGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTATAATTTCTCAAATAATACCTACTTTTGTTGCTAAAAAACAAATTTTTGGGTATTTAGGGATGGTTTATGCGATGCTTTCAATTGGTCTTCTTGGGTTTATTGTTTGAGCCCATCATATGTTTACAGTTGGGATGGATGTGGACACAAGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Montastraea franksi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
VU
Vulnerable
Red List Criteria
A4ce
Version
3.1
Year Assessed
2008
Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil
Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)
Contributor/s
Justification
This species is widespread and common in the Caribbean. However, this species is particularly susceptible to disease and the population has declined over the last ten years due to this. Extensive reduction of coral reef habitat due to a combination of threats has also occurred. Population reduction can be inferred from declines in habitat quality based on the combined estimates of both destroyed reefs and reefs at the critical stage of degradation within its range (Wilkinson 2004). Its threat susceptibility increases the likelihood of being lost within one generation in the future from reefs at a critical stage. Therefore, the estimated habitat degradation and loss of 38% over three generation lengths (30 years) is the best inference of population reduction and meets the threshold for Vulnerable under Criterion A4ce. It will be important to reassess this species in 10 years time because of predicted threats from climate change and ocean acidification.
Trusted
Trends
Population
Population
Population Trend
In the last 20 years, there has been a severe decline in the overall cover and abundance of M. annularis in several parts of the Caribbean. Declines in M. franksi appear to have taken place mainly in the past 10 years. Although this coral appears to be more resistant to disease than the other species in the complex, since 2002 in US waters, there has been an accelerating decline in cover (A. Bruckner and E. Weil pers. comm.).
There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.
The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.
There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.
The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.
Population Trend
Decreasing
Trusted
Threats
Major Threats
The major threats to the species are infectious diseases (e.g., plague, yellow band and black band disease) and bleaching. Other threats include loss of habitat at the recruitment stage due to algal overgrowth and sedimentation, as well as localized impacts due to bioerosion by sponges and other organisms, and other diseases.
In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.
Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.
Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.
The severity of these combined threats to the global population of each individual species is not known.
In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.
Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.
Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.
The severity of these combined threats to the global population of each individual species is not known.
Trusted
Management
Conservation Actions
Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. In the Marine Conservation District off St Croix this species is the most abundant coral species. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. There is a need for more quantitative information on the status of the populations in deeper habitats. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)
All corals are listed on CITES Appendix II.
Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
All corals are listed on CITES Appendix II.
Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

