Ecology

Habitat

coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 67 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0 - 886.5
  Temperature range (°C): 4.251 - 26.751
  Nitrate (umol/L): 0.152 - 30.254
  Salinity (PPS): 32.799 - 35.691
  Oxygen (ml/l): 4.398 - 7.472
  Phosphate (umol/l): 0.120 - 1.968
  Silicate (umol/l): 0.711 - 47.204

Graphical representation

Depth range (m): 0 - 886.5

Temperature range (°C): 4.251 - 26.751

Nitrate (umol/L): 0.152 - 30.254

Salinity (PPS): 32.799 - 35.691

Oxygen (ml/l): 4.398 - 7.472

Phosphate (umol/l): 0.120 - 1.968

Silicate (umol/l): 0.711 - 47.204
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Achelia assimilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACAATATATTTAATCTTTGGTGCATGAGCAGCAATAGTAGGTACTTCCCTAAGTCTATTAATCCGTACTGAACTAGGAACACCTTCCTCATTAATTGGAGAT---GACCAAATTTATAATGTAATTGTGACATCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATAATAATTGGAGGATTTGGAAATTGGTTAGTACCTTTAATAATTGGAGCACCAGATATAGCTTTTCCCCGTATAAATAATATAAGATTCTGGCTATTACCACCTTCATTATTATTATTATTAACATCTTCCCTTGTAGAAATAGGAAGAGGAACTGGATGGACTGTATACCCACCTCTTTCATCTAACATTGCACACTCAGGATCGTCTGTAGATTTAACAATTTTCTCTCTACATCTAGCCGGTGTTTCCTCTATTTTAGGAGCAATCAATTTTATTAGTACAATTATAAATATGCGTAGACCAGGAATAAAACTAGAAACAATACCATTATTTGTGTGAAGAGTTTTAATCACTGCAATTCTTTTATTATTATCACTACCTGTTTTAGCAGGAGCAATTACAATACTATTAACAGACCGTAACTTTAATACATCATTTTTTGACCCTGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTCTTCGGGCACCCCGAAGTATATATTTTAATTTTACCAGGATTCGGAATAATCTCACATATTTTAATGTCAGAAAGAGGTAAAAAAGAAGTATTTGGTAATTTGGGTATAATTTATGCTATAGCAGCAATCGGGTTTTTAGGTTTTATTGTATGGGCTCACCATATATTTACTGTGGGAATAGATGTAGACACTCGTGCATATTTCACCTCAGCAACAATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGATGAATAGCTACAATTCATGGTTCA---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Achelia assimilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!