Articles on this page are available in 1 other language: Spanish (14) (learn more)
Overview
Brief Summary
Biology
zooxanthellate
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Comprehensive Description
Biology: Skeleton
More info
| Author | Skeleton? | Mineral or Organic? | Mineral | Percent Magnesium |
|---|---|---|---|---|
| Cairns, Hoeksema, and van der Land, 1999 | YES | MINERAL | ARAGONITE | |
| Veron, 2000 | YES | MINERAL | ARAGONITE |
Trusted
Distribution
Range Description
In the Indo-West Pacific, this species is found in the Red Sea and the Gulf of Aden, the southwest and central Indian Ocean, the central Indo-Pacific, tropical Australia, Southern, Japan and the South China Sea, the oceanic West Pacific, the central Pacific, and the far eastern Pacific.
Widespread distribution within Eastern Tropical Pacific: México: Baja California Sur (San José Island, La Paz, Cerralvo Island and from Cabo Pulmo to Cabo San Lucas), Revillagigedo Archipelago, Nayarit, Jalisco (from Banderas Bay to Tenacatita Bay), Colima (Manzanillo) and Oaxaca (from Puerto Escondido to Huatulco) (Reyes-Bonilla and Lopez 1998, Calderon-Aguilera 2005, Ketchum and Reyes-Bonilla 2001, Glynn and Ault 2000, Reyes-Bonilla et al. 2005, Perez-Vivar et al. 2006, Reyes-Bonilla 2003, Reyes-Bonilla et al. 2005); Costa Rica: Islas Murciélago Archipelago, Bahía Culebra, Manuel Antonio, Peninsula de Osa, Golfo Dulce, Caño Island and Cocos Island (Guzman and Cortes 1992, Cortés and Guzmán 1998, Glynn and Ault 2000, Cortés and Jiménez 2003); Panamá: throughout the Gulf of Chiriquí and the Gulf of Panamá (Holst and Guzman 1993, Glynn and Maté 1997, Maté 2003); Colombia: Malpelo, Gorgona and Ensenada de Utría (Glynn and Ault 2000, Zapata and Vargas-Ángel 2003); Ecuador: Salango Island, Los Frailes, Sucre Island, La Plata Island and throughout the Galápagos Island (Glynn 2003); Clipperton (Reyes-Bonilla 2002).
Widespread distribution within Eastern Tropical Pacific: México: Baja California Sur (San José Island, La Paz, Cerralvo Island and from Cabo Pulmo to Cabo San Lucas), Revillagigedo Archipelago, Nayarit, Jalisco (from Banderas Bay to Tenacatita Bay), Colima (Manzanillo) and Oaxaca (from Puerto Escondido to Huatulco) (Reyes-Bonilla and Lopez 1998, Calderon-Aguilera 2005, Ketchum and Reyes-Bonilla 2001, Glynn and Ault 2000, Reyes-Bonilla et al. 2005, Perez-Vivar et al. 2006, Reyes-Bonilla 2003, Reyes-Bonilla et al. 2005); Costa Rica: Islas Murciélago Archipelago, Bahía Culebra, Manuel Antonio, Peninsula de Osa, Golfo Dulce, Caño Island and Cocos Island (Guzman and Cortes 1992, Cortés and Guzmán 1998, Glynn and Ault 2000, Cortés and Jiménez 2003); Panamá: throughout the Gulf of Chiriquí and the Gulf of Panamá (Holst and Guzman 1993, Glynn and Maté 1997, Maté 2003); Colombia: Malpelo, Gorgona and Ensenada de Utría (Glynn and Ault 2000, Zapata and Vargas-Ángel 2003); Ecuador: Salango Island, Los Frailes, Sucre Island, La Plata Island and throughout the Galápagos Island (Glynn 2003); Clipperton (Reyes-Bonilla 2002).
Trusted
Chagos, Indo-Pacific, Kenya, Madagascar, Mauritius, Mozambique, Reunion, Rodriguez, Seychelles, South Africa (country)
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Sheppard, C.R.C. (1998). Corals of the Indian Ocean: a taxonomic and distribution database for coral reef ecologists
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6092
-
Lemmens, J.W.T.J. (1993). Reef-building corals (Cnidaria: Scleractinia) from the Watamu Marine National Reserve, Kenya; an annotated species list. Zoologische mededelingen 67, 453-465
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5875
-
Fauré, G. (1977). Annotated checklist of the corals in the Mascarene Archipelago, Indian Ocean. Atoll Research Bulletin 203: 1-26
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5899
-
Best, W.G., G. Faure & M. Pichon (1980). Contribution to the knowledge of the stony corals from the Seychelles and Eastern Africa. Rev. Zool. Afr. 94,3: 600 - 627.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6043
-
Sheppard, C.R.C. (1981). The Reef and Soft-substrate coral fauna of Chagos, Indian Ocean.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6031
-
Sheppard, C.R.C. (1987). [Pichon]
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5879
-
McClanahan, T.R. & J.C. Mutere (1994). Coral and sea urchin assemblage structure and interrelationships in Kenyan reef lagoons
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5877
-
Sheppard, C.R.C. (1987). [Best; Boshof]
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5878
-
Sheppard, C.R.C (1987). [Best et al, boshof]
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5902
-
Schleyer, M.H. (1995). South African coral reef communities. In: Cowan G.I. (ed) Wetlands of South Africa. Department of Environmental Affairs and Tourism, Pretoria.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6220
Trusted
Physical Description
Diagnostic Description
Description
The species has distinctive colonies which are basically massive, but with numerous club shaped or cylindrical, stout columns. These columns divide, and are usually oval in cross-section, and then remain separate from adjacent columns. The typical, star shaped Pavona corallites are clearly visible in live corals, and like most Pavona, the corallite walls are thick, so the calices are well separated. The smooth edged septa cross the broad walls. This is common in the central Indian Ocean, and has been listed for the northern Red Sea, but if present, it is extremely rare there. The colonies commonly reach a metre high and a metre across. The living colour is usually brown or green (Sheppard, 1998). Colonies are columnar or laminar, or both. Columns divide but do not anastomose. Corallites are thick-walled. Columellae are short or absent. Colour: uniform pale grey, cream or brown. Abundance: common on some shallow upper reef slopes exposed to currents, and may be dominant coral forming extensive monospecific stands (Veron, 1986). Grows in plates or stout columns, or a combination of both. Colour: varies from pale grey or green to yellowish-brown. Habitat: shallow reefs with strong currents (Richmond, 1997)
-
Veron, J.E.N. (1986). Corals of Australia and the Indo-Pacific. Angus & Robertson Publishers, London.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5874
Trusted
Type Information
Syntype for Pavona clavus Dana, 1846
Catalog Number: USNM 221
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1838
Locality: Fiji, South Pacific Ocean
Catalog Number: USNM 221
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1838
Locality: Fiji, South Pacific Ocean
- Syntype: Dana. 1846. Zoophytes. 7: 332-333, pl.24, fig.4.
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
It occurs on reef slopes. It commonly occurs in habitats exposed to currents from 2-15 m. It may form large fields.
In the Eastern Tropical Pacific region, Pavona clavus occurs broadly on coral reefs and coral communities on rocks, except from shallow platforms with high energy (Cortés and Guzmán 1998; Guzmán pers. comm.); in some locations the species can also occur in cryptic habitats (Chiriboga pers. comm.), on soft bottoms (Guzmán pers. comm.), and in habitats exposed to currents Veron (2000). P. clavus occurs as isolated colonies or can develop large patches (Guzmán pers. comm.). P. clavus, along with Pavona gigantea and Porites lobata, can sometimes build reef frameworks or assist pocilloporid corals in reef building (Glynn 2001). According to Cortés and Guzmán (1993), the growth rates of P. clavus vary between 0.9 and 1.3 cm/yr. Pavona clavus colonies are preferred prey for Acanthaster planci, which can limit the coral’s abundance (Cortés and Guzmán 1998).
In the Eastern Tropical Pacific region, Pavona clavus occurs broadly on coral reefs and coral communities on rocks, except from shallow platforms with high energy (Cortés and Guzmán 1998; Guzmán pers. comm.); in some locations the species can also occur in cryptic habitats (Chiriboga pers. comm.), on soft bottoms (Guzmán pers. comm.), and in habitats exposed to currents Veron (2000). P. clavus occurs as isolated colonies or can develop large patches (Guzmán pers. comm.). P. clavus, along with Pavona gigantea and Porites lobata, can sometimes build reef frameworks or assist pocilloporid corals in reef building (Glynn 2001). According to Cortés and Guzmán (1993), the growth rates of P. clavus vary between 0.9 and 1.3 cm/yr. Pavona clavus colonies are preferred prey for Acanthaster planci, which can limit the coral’s abundance (Cortés and Guzmán 1998).
Systems
- Marine
Trusted
Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.
Environmental ranges
Depth range (m): 0 - 51.5
Temperature range (°C): 22.344 - 28.617
Nitrate (umol/L): 0.046 - 6.523
Salinity (PPS): 33.198 - 35.472
Oxygen (ml/l): 4.215 - 4.783
Phosphate (umol/l): 0.081 - 0.824
Silicate (umol/l): 0.523 - 6.846
Graphical representation
Depth range (m): 0 - 51.5
Temperature range (°C): 22.344 - 28.617
Nitrate (umol/L): 0.046 - 6.523
Salinity (PPS): 33.198 - 35.472
Oxygen (ml/l): 4.215 - 4.783
Phosphate (umol/l): 0.081 - 0.824
Silicate (umol/l): 0.523 - 6.846
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 36 samples.
Environmental ranges
Depth range (m): 0 - 51.5
Temperature range (°C): 22.344 - 28.617
Nitrate (umol/L): 0.046 - 6.523
Salinity (PPS): 33.198 - 35.472
Oxygen (ml/l): 4.215 - 4.783
Phosphate (umol/l): 0.081 - 0.824
Silicate (umol/l): 0.523 - 6.846
Graphical representation
Depth range (m): 0 - 51.5
Temperature range (°C): 22.344 - 28.617
Nitrate (umol/L): 0.046 - 6.523
Salinity (PPS): 33.198 - 35.472
Oxygen (ml/l): 4.215 - 4.783
Phosphate (umol/l): 0.081 - 0.824
Silicate (umol/l): 0.523 - 6.846
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pavona clavus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATTCGCTGGGGTTTTTCAACAAACCATAAAGACATTGGTACGTTATATTTAGTATTTGGGATTGGAGCAGGTATGCTTGGTACGGCCTTCAGTATGTTAATAAGATTAGAGCTTTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACATGCGTTTATTATGATTTTTTTTTTGGTTATGCCAGTAATGATTGGGGGGTTTGGGAATTGGTTGGTTCCACTATATATTGGTGCGCCCGATATGGCCTTCCCCCGGCTTAATAATATTAGTTTTTGGTTGTTGCCCCCTGCTTTAATATTATTATTAGGCTCCGCTTTTGTTGAACAAGGAGTCGGCACCGGATGGACGGTTTATCCTCCTTTGTCGAGCATTCAAGCCCACTCTGGTGGGGCGGTGGATATGGCTATTTTTAGCCTTCACTTAGCTGGGGCGTCTTCGATTTTGGGCGCAATGAATTTTATAACAACTATATTAAATATGCGAGCCCCCGGGATGACGTTAGATAAAATGCCATTGTTTGTGTGGTCTATTTTGATCACTGCTTTTTTATTATTATTGTCTTTACCAGTATTAGCGGGGGCCATAACCATGCTATTAACGGATAGAAATTTTAATACCACCTTTTTTGACCCCGCAGGAGGAGGCGATCCAATTTTATTTCAGCATTTGTTTTGGTTTTTTGGACATCCAGAGGTTTATATTTTAATATTACCTGGCTTTGGCATGATCTCTCAAATAATACCAACTTTTGTTGCTAAGAAGCAGATTTTTGGCTACTTAGGAATGGTGTATGCAATGCTTTCAATTGGAATATTGGGCTTTATTGTGTGGGCCCATCATATGTTTACGGTTGGGATGGATGTGGACACAAGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pavona clavus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2008
Assessor/s
Hoeksema, B., Rogers, A. & Quibilan, M.
Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)
Contributor/s
Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread and common throughout its range. The estimated habitat loss of 20% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Trusted
Trends
Population
Population
Population Trend
This is common species in habitats exposed to currents.
The relative abundance of Pavona clavus in the Eastern Tropical Pacific region has been categorized as:
Abundant: Caño Island, Costa Rica (Guzmán and Cortés 2001), and Coiba Archipelago, several islands in gulfs of Chiriqui and Panamá (Guzmán et al. 2004, Guzmán pers. comm.).
Common: Mexico (Reyes-Bonilla 2003); Costa Rica (including Cocos Island) (Guzman and Cortes 1992, Cortés and Guzmán 1998, Cortés and Jiménez 2003), Panamá (Guzmán pers. comm.), Colombia (Glynn and Ault 2000, Guzmán pers. comm.), Ecuador (Glynn 2003) and throughout the Galápagos Archipelago, except at Fernandina and the west side of Isabela (Glynn 2003, Hickman 2005, Edgar and Hickman pers. comm.).
According to Guzmán (pers. comm.), populations of Pavona clavus are probably increasing in recent decades after the severe impacts of 1982-83 El Niño event. Guzmán et al. (2004), reported P. clavus as an abundant species at Coiba Archipelago (present in 75-100% of the sites).
There is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.
The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.
The relative abundance of Pavona clavus in the Eastern Tropical Pacific region has been categorized as:
Abundant: Caño Island, Costa Rica (Guzmán and Cortés 2001), and Coiba Archipelago, several islands in gulfs of Chiriqui and Panamá (Guzmán et al. 2004, Guzmán pers. comm.).
Common: Mexico (Reyes-Bonilla 2003); Costa Rica (including Cocos Island) (Guzman and Cortes 1992, Cortés and Guzmán 1998, Cortés and Jiménez 2003), Panamá (Guzmán pers. comm.), Colombia (Glynn and Ault 2000, Guzmán pers. comm.), Ecuador (Glynn 2003) and throughout the Galápagos Archipelago, except at Fernandina and the west side of Isabela (Glynn 2003, Hickman 2005, Edgar and Hickman pers. comm.).
According to Guzmán (pers. comm.), populations of Pavona clavus are probably increasing in recent decades after the severe impacts of 1982-83 El Niño event. Guzmán et al. (2004), reported P. clavus as an abundant species at Coiba Archipelago (present in 75-100% of the sites).
There is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.
The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.
Population Trend
Unknown
Trusted
Threats
Major Threats
This species is presumably threatened by ENSO events and climate change.
The total number of corals (live and raw) exported for this species in 2005 was 100.
This species exhibited high bleaching and mortality in the 1998 bleaching event in Palau (Brunno et al. 2001). In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.
Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the GBR were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.
Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.
The severity of these combined threats to the global population of each individual species is not known.
El Niño Southern Oscillation (ENSO) events are the most important source of natural disturbance controlling coral communities (Glynn 1990). Pavona species have a high sensitivity to extreme elevated temperatures that interfere with reproduction and recruitment (Glynn et al. 2000). El Niño disturbance could have perilous consequences for small populations of eastern Pacific reef corals (Glynn 1988).
Bryant et al. (1998), based on four anthropogenic factors (coastal development; overexploitation and destructive fishing practice; inland pollution and erosion, and marine pollution), estimated a high threat to coral reefs in the coast of Costa Rica, Panama and Colombia. High levels of siltation caused by accelerated coastal erosion have degraded coral reefs in Costa Rica, Colombia and Ecuador (Glynn 2001).
Other threats (Glynn et al. 2000): small colony size; slow skeletal growth; susceptibility to Acanthaster planci predation, and infrequent asexual fragmentation.
The total number of corals (live and raw) exported for this species in 2005 was 100.
This species exhibited high bleaching and mortality in the 1998 bleaching event in Palau (Brunno et al. 2001). In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.
Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the GBR were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.
Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.
The severity of these combined threats to the global population of each individual species is not known.
El Niño Southern Oscillation (ENSO) events are the most important source of natural disturbance controlling coral communities (Glynn 1990). Pavona species have a high sensitivity to extreme elevated temperatures that interfere with reproduction and recruitment (Glynn et al. 2000). El Niño disturbance could have perilous consequences for small populations of eastern Pacific reef corals (Glynn 1988).
Bryant et al. (1998), based on four anthropogenic factors (coastal development; overexploitation and destructive fishing practice; inland pollution and erosion, and marine pollution), estimated a high threat to coral reefs in the coast of Costa Rica, Panama and Colombia. High levels of siltation caused by accelerated coastal erosion have degraded coral reefs in Costa Rica, Colombia and Ecuador (Glynn 2001).
Other threats (Glynn et al. 2000): small colony size; slow skeletal growth; susceptibility to Acanthaster planci predation, and infrequent asexual fragmentation.
Trusted
Management
Conservation Actions
Conservation Actions
All corals are listed on CITES Appendix II. Parts of the species’ range fall within Marine Protected Areas.
Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting. Recommended conservation measures include population surveys to monitor the effects of collecting for the aquarium trade, especially in Indonesia.
Present in multiple protected areas in the Eastern Tropical Pacific region:
México: Islas del Golfo de California, Flora and Fauna Protection Area (IUCN category VI); Islands and Protected Areas of the Gulf of California, World Heritage Site (UNESCO N (ii)(iii)); Cabo San Lucas, Flora and Fauna Protection Area (IUCN category VI); Cabo Pulmo National Park (IUCN category II); El Veladero National Park (IUCN category II); Huatulco National Park (IUCN category II); Cuencas y corales de la zona costera de Huatulco (Wetlands of International Importance, Ramsar), and Archipielago de Revillagigedo Biosphere Reserve (IUCN category Ia, VI).
Costa Rica: Manuel Antonio National Park (IUCN category II); Isla del Caño Biological Reserve (IUCN category Ia); Golfito National Wildlife Refuge (IUCN category IV); Corcovado National Park (IUCN category II); Cocos Island National Park (IUCN category II), and Cocos Island World Heritage Site (UNESCO criteria N (ii)(iv)).
Panamá: Iguana Wildlife Refuge (IUCN category IV); Coiba National Park (IUCN category II); Coiba Special Zone of Marine Protection (IUCN category II), and Coiba National Park and its Special Zone of Marine Protection, World Heritage Site (UNESCO N (ii)(iii), C (iv)); Golfo de Chiriqui National Marine Park (IUCN category II), and Isla San Jose and Isla San Telmo Private Reserves (Las Perlas archipelago).
Colombia: Malpelo Island Particularly Sensitive Sea Areas (PSSA); Malpelo Fauna and Flora Sanctuary World Heritage Site (UNESCO N (ii)(iii)), Isla Gorgona Natural National Park (IUCN category II).
Ecuador: Machalilla National Park (IUCN category II); Zona Marina Parque Nacional Machalilla (Wetlands of International Importance, Ramsar); Galápagos Marine Reserve (IUCN category VI); Galápagos Archipelago Particularly Sensitive Sea Area (PSSA); Galapagos Island World Heritage Site (UNESCO N (i)(ii)(iii)(iv)), and Galapagos Island Man and Biosphere Reserve (UNESCO)
Included with corals in CITES appendix II.
Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting. Recommended conservation measures include population surveys to monitor the effects of collecting for the aquarium trade, especially in Indonesia.
Present in multiple protected areas in the Eastern Tropical Pacific region:
México: Islas del Golfo de California, Flora and Fauna Protection Area (IUCN category VI); Islands and Protected Areas of the Gulf of California, World Heritage Site (UNESCO N (ii)(iii)); Cabo San Lucas, Flora and Fauna Protection Area (IUCN category VI); Cabo Pulmo National Park (IUCN category II); El Veladero National Park (IUCN category II); Huatulco National Park (IUCN category II); Cuencas y corales de la zona costera de Huatulco (Wetlands of International Importance, Ramsar), and Archipielago de Revillagigedo Biosphere Reserve (IUCN category Ia, VI).
Costa Rica: Manuel Antonio National Park (IUCN category II); Isla del Caño Biological Reserve (IUCN category Ia); Golfito National Wildlife Refuge (IUCN category IV); Corcovado National Park (IUCN category II); Cocos Island National Park (IUCN category II), and Cocos Island World Heritage Site (UNESCO criteria N (ii)(iv)).
Panamá: Iguana Wildlife Refuge (IUCN category IV); Coiba National Park (IUCN category II); Coiba Special Zone of Marine Protection (IUCN category II), and Coiba National Park and its Special Zone of Marine Protection, World Heritage Site (UNESCO N (ii)(iii), C (iv)); Golfo de Chiriqui National Marine Park (IUCN category II), and Isla San Jose and Isla San Telmo Private Reserves (Las Perlas archipelago).
Colombia: Malpelo Island Particularly Sensitive Sea Areas (PSSA); Malpelo Fauna and Flora Sanctuary World Heritage Site (UNESCO N (ii)(iii)), Isla Gorgona Natural National Park (IUCN category II).
Ecuador: Machalilla National Park (IUCN category II); Zona Marina Parque Nacional Machalilla (Wetlands of International Importance, Ramsar); Galápagos Marine Reserve (IUCN category VI); Galápagos Archipelago Particularly Sensitive Sea Area (PSSA); Galapagos Island World Heritage Site (UNESCO N (i)(ii)(iii)(iv)), and Galapagos Island Man and Biosphere Reserve (UNESCO)
Included with corals in CITES appendix II.
Trusted

