Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, and the Bahamas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Moderately widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, Jamaica, Belize, Lesser Antilles, Curacao and Bonaire.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Type Information

Neotype for Agaricia lamarcki Milne Edwards & Haime, 1851
Catalog Number: USNM 53486
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Blue Hole, Jamaica, Caribbean Sea, North Atlantic Ocean
Depth (m): 12 to 12
  • Neotype: Wells. 1973. Bull. Mar. Sci. Gulf Caribb. 23 (1): 26, fig. 8-9.; Milne Edwards & Haime. 1851. Ann. Sci. Nat. Zool. 6(3)15: 128.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Occupies depth range from 3-46 m but does extend to 76 m on deep intermediate reefs and deep reef slopes (Wells, 1973a; Reed, 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in fore reef, slope, deep channels and deep lagoon environments. Recorded from 10-76 m (Reed 1985), but most common from 15-25 m (E. Weil and A. Bruckner pers. comm.), and especially at shallower depths (10-15m) in highly turbid waters.

This species forms large overlapping shingles.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 131 specimens in 1 taxon.
Water temperature and chemistry ranges based on 91 samples.

Environmental ranges
  Depth range (m): 2.1 - 887.5
  Temperature range (°C): 5.788 - 27.863
  Nitrate (umol/L): 0.159 - 31.714
  Salinity (PPS): 34.886 - 36.531
  Oxygen (ml/l): 3.107 - 4.895
  Phosphate (umol/l): 0.027 - 1.745
  Silicate (umol/l): 0.866 - 22.648

Graphical representation

Depth range (m): 2.1 - 887.5

Temperature range (°C): 5.788 - 27.863

Nitrate (umol/L): 0.159 - 31.714

Salinity (PPS): 34.886 - 36.531

Oxygen (ml/l): 3.107 - 4.895

Phosphate (umol/l): 0.027 - 1.745

Silicate (umol/l): 0.866 - 22.648
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

1000 - 2500 individuals

Comments: Restricted to spur and groove reefs, deep intermediate reefs and fore-reef slope communities (Goldberg, 1973; Cairns, 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

A90GHI01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A88POR01FCUS: competition and allelochemical reactions from sponges.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

A79BAK02FCUS, A88ROG00FCUS: low reported recruitment rates. No information on reproductive ecology in resources consulted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agaricia lamarcki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACGTTATATTTAGTATTTGGGATTGGAGCAGGTATGCTCGGTACGGCCTTCAGTATGTTAATAAGATTAGAGCTTTCGGCCCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACATGCGTTTATTATGATTTTTTTTTTGGTTATGCCAGTAATGATTGGGGGGTTTGGGAATTGGTTGGTTCCACTATATATTGGTGCGCCCGATATGGCCTTCCCCCGGCTTAATAATATTAGTTTTTGGTTGTTGCCCCCGGCTTTAATATTATTATTAGGCTCCGCTTTTGTTGAACAAGGAGTCGGCACCGGATGGACGGTTTATCCCCCTTTGTCGAGCATTCAAGCCCACTCTGGTGGGGCGGTGGATATGGCTATTTTTAGCCTTCACTTAGCTGGGGCGTCTTCGATTTTGGGCGCAATGAATTTTATAACAACTATATTTAATATGCGAGCCCCCGGAATGACGTTAGATAAAATGCCATTGTTTGTGTGGTCTATTTTGATCACTGCTTTTTTATTATTATTGTCTTTGCCAGTATTAGCGGGGGCCATAACCATGCTATTAACGGATCGAAATTTTAATACCACTTTTTTTGACCCCGCAGGAGGAGGCGACCCAATTTTATTTCAGCATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agaricia lamarcki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: This species is listed as vulnerable by the IUCN primarily because there have been significant declines in some populations, with a total of almost a 40% decline over 30 years (Aronson et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4ce

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is listed as Vulnerable as available information indicates that the species has undergone significant localized declines in the past and which are ongoing (e.g., in Puerto Rico, Netherlands Antilles, Florida, and Jamaica) due to bleaching and disease. The estimated decline of both destroyed and declining reefs is on the order of 38% over three generations (30 years). In localities affected by mass mortality events in the late 1980s, little or no recovery was observed; additionally, no information on recovery is available from the 2005 event. Since this species occurs in large overlapping shingles, and is susceptible to an extremely virulent disease (white plague) that readily spreads from one colony to another, this is likely to cause continued declines and may inhibit recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common in intermediate to deep water. This is the dominant species at the base of the reef in the southern and western Caribbean.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Susceptible to bleaching but no other threats cited from resources consulted (Ghiold and Smith, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The major long-term threat to this species has been bleaching with reported mortality during the 1987/1988, 1990, 1995, 1998 and 2005 bleaching events in various places throughout the wider Caribbean, including Puerto Rico, Netherlands Antilles, Florida, and Jamaica (Sebens 1994, A. Bruckner, B. Precht and E. Weil pers. comm.). They are particularly susceptible to bleaching because they have very thin tissues and a limited ability to cope with the affects of temperature. Since 2001, there has been a dramatic increase in the occurrence of white plague and increasing rates of mortality. Localized declines result from other disease (black band) and high sedimentation.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Data needed on colony growth, reproduction and recruitment patterns. Information needed on susceptibility to sedimentation, eutrophication and disease.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Populations in marine protected areas restricted to the Florida Keys National Marine Sanctuary and Dry Tortugas, Florida.

Needs: Extant populations need to be included in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes.

There is a need for more quantitative information on the status of the populations and rates of recovery in deep-water habitats.

All corals are listed on CITES Appendix II. Parts of the species’ range fall within Marine Protected Areas.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Zlatarski and Estalella (1982) synonymized this species with Agaricia agaricites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!