Overview

Brief Summary

Introduction

Introduction:

The cabbage whites are an almost cosmopolitan group. Pieris rapae is a pest of cole crops.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

The cabbage whites are an almost cosmopolitan group. Pieris rapae is a pest of cole crops.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Epicampocera succincta is endoparasitoid of larva of Pieris (zoo)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pieris canidia palaearctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTCGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAACTGAATTAGGAAACCCAGGGTTTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGTAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGATTACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGACCAAATACCACTATTTGTATGAGCTGTAGGAATCACAGCTTTACTTTTATTATTATCATTGCCAGTTCTAGCAGGAGCAATTACAATACTTTTAACAGACCGAAATTTAAATACTTCATTTTTTGACCCCGCTGGAGGGGGAGATCCTATTCTTTACCAGCACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pieris canidia palaearctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 1123
Specimens with Sequences: 1023
Specimens with Barcodes: 971
Species: 43
Species With Barcodes: 40
Public Records: 269
Public Species: 29
Public BINs: 11
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 2
Specimens with Sequences: 2
Specimens with Barcodes: 2
Species: 2
Species With Barcodes: 2
Public Records: 1
Public Species: 1
Public BINs: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pieris (butterfly)

Veined White (Pieris napi)

Pieris, the whites or garden whites, is a widespread genus of butterflies of the family Pieridae. Many species of this genus have caterpillars which feed on cabbage and other members of the Brassicaceae. The chemical basis of this association with a certain plant group has been studied for over 100 years, and is now known to occur via a number of biochemical adaptations to chemicals called glucosinolates in these plants. In contrast to most other insects, Pieris caterpillars are able to detoxify these chemicals, and have become so specialised that they will not eat any food without glucosinolates. The Pieris females, in turn, check for the presence of glucosinolates before laying eggs on a plant. The crop-damaging species have spread from Eurasia to most of the rest of the world and are considered pest insects almost everywhere.

The females of many Pieris butterflies are UV reflecting, while the male wings are strongly UV absorbing due to pigments in the scales.[citation needed]

Species and notable subspecies[edit]

Arranged alphabetically.[1][2]

References[edit]

  1. ^ Pieris, funet.fi
  2. ^ Pieris, BioLib.cz

Further reading[edit]

  • Glassberg, Jeffrey Butterflies through Binoculars, The West (2001)
  • Guppy, Crispin S. and Shepard, Jon H. Butterflies of British Columbia (2001)
  • James, David G. and Nunnallee, David Life Histories of Cascadia Butterflies (2011)
  • Pelham, Jonathan Catalogue of the Butterflies of the United States and Canada (2008)
  • Pyle, Robert Michael The Butterflies of Cascadia (2002)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!