Overview

Brief Summary

Introduction

Introduction:

The genus has a circumtropical distribution with the bulk of species in South and Central America. Parsons (1999) states that Yata (1989) included four non-neotropical species in Eurema - E. brigitta, E. desjardinsii, E. herla, and E. laeta. The remainder of Old World "Eurema" s. l. belong in Terias.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

The genus has a circumtropical distribution with the bulk of species in South and Central America. Parsons (1999) states that Yata (1989) included four non-neotropical species in Eurema - E. brigitta, E. desjardinsii, E. herla, and E. laeta. The remainder of Old World "Eurema" s. l. belong in Terias.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General comments

TW

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:709
Specimens with Sequences:611
Specimens with Barcodes:579
Species:64
Species With Barcodes:57
Public Records:234
Public Species:30
Public BINs:22
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurema Janzen01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurema desjardinsi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eurema albulaDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATACTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGGACAGAATTAGGTAACCCTGGCTCATTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATCCCTTTAATACTTGGAGCCCCAGACATAGCATTTCCACGTATAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTACTCTTTTAATTTCTAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCTTTATCATCTAATATTGCTCATAGAGGTTCTTCTGTAGACTTAGCTATTTTCTCATTACATTTAGCAGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCATTATTTGTATGAGCTGTTGGTATTACAGCCTTACTTCTTTTACTTTCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACGTCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurema albulaDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eurema albulaDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTAGGAACTTCTTTAAGACTTTTAATTCGAACAGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATACTCGGAGCTCCAGACATAGCATTTCCACGTATAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTACTCTTTTAATTTCTAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCTTTATCATCTAATATTGCTCATAGAGGTTCTTCTGTAGACTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTACTACTATTNNTNNNNNACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTTGGTATTACAGCCTTACTTCTTTTACTTTCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurema albulaDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurema

Eurema blanda- Three-spot Grass Yellow
Eurema brigitta- Small Grass Yellow
Eurema hecabe- Common Grass Yellow

Eurema is a widespread genus of grass yellow butterflies in the family Pieridae.

Species range from Asia, Africa, Australia, and Oceania, to the New World. The type species is the North American Barred Yellow (Eurema daira).

There are over 70 species in the genus, but more than 300 synonymous names have been applied to them. Some species, such as the common African grass yellow, E. hecabe, have over 80 synonyms. The genus itself has over 15 junior generic synonyms. This is the price of being a widespread taxon, as well as a zoogeographical problem.

Species[edit]

Listed alphabetically within groups.[1]

Species group:

Species group abaeis:

Species group pyrisitia:

Species-group teriocolias:

Unknown species group

References[edit]

  1. ^ Eurema, page on Markku Savela's butterfly website
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!