Overview

Distribution

Range Description

P. t. ellioti (Gray, 1862) is found only in Nigeria and Cameroon, north of the Sanaga River.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Chimpanzees are found predominantly in moist and dry forests, and forest galleries extending into savanna woodlands. They are omnivorous, and their diet is highly variable according to individual populations and seasons. Fruit comprises about half the diet, but leaves, bark, and stems are also important. Mammals comprise a small but significant component of the diet of many populations. Chimpanzees form social communities of 5 to 150 animals. Home ranges are larger in woodland forest mosaics than in mixed forest, and average 12.5 km² (range 5 to 400 km²).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pan troglodytes ellioti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGCGCATGAGCTGGAGTCCTGGGCACAGCCCTAAGTCTCCTTATTCGGGCTGAACTAGGCCAACCAGGCAACCTTCTAGGTAATGACCACATCTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATTATAATCGGAGGCTTTGGCAACTGGCTAGTTCCCTTGATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGGCTCCTGCCCCCTTCTCTCCTACTCCTACTTGCATCTGCCATAGTAGAAGCCGGCGCCGGAACAGGTTGAACAGTCTACCCTCCCTTAGCGGGAAACTACTCGCATCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTGCATCTGGCAGGCGTCTCCTCTATCCTAGGAGCCATTAACTTCATCACAACAATTATTAATATAAAACCTCCTGCCATGACCCAATACCAAACACCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCTGGCATCACCATACTATTGACAGATCGTAACCTCAACACTACCTTCTTCGACCCAGCCGGGGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTTTTTGGCCACCCCGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATTTCCCACATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATATATAGGCATGGTTTGAGCTATAATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCCTATTTCACCTCCGCTACCATAATCATTGCTATTCCTACCGGCGTCAAAGTATTCAGCTGACTCGCTACACTTCACGGAAGCAATATGAAATGATCTGCCGCAGTACTCTGAGCCCTAGGGTTTATCTTTCTCTTCACCGTAGGTGGCCTAACCGGCATTGTACTAGCAAACTCATCATTAGACATCGTGCTACACGACACATACTACGTCGTAGCCCACTTCCACTATGTTCTATCAATAGGAGCTGTATTCGCCATCATAGGGGGCTTCATTCACTGATTCCCCCTATTCTCAGGCTATACCCTAGACCAAACCTATGCCAAAATCCAATTTGCCATCATGTTCATTGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTTGGCCTATCTGGGATGCCCCGACGTTACTCGGACTACCCCGATGCATATACCACATGAAATGTCCTATCATCCGTAGGCTCATTTATCTCCCTGACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTTGCTTCAAAACGAAAAGTCCTAATAGTAGAAGAGCCCTCCACAAACCTGGAATGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pan troglodytes ellioti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Oates, J.F., Dunn, A., Greengrass, E. & Morgan, B.J.

Reviewer/s
Mittermeier, R.A., Butynski, T.M. & Williamson, E.A. (Primate Red List Authority)

Contributor/s

Justification
Due to high levels of exploitation, loss of habitat and habitat quality due to expanding human activities, this subspecies is estimated to have experienced a significant population reduction in the past 20 to 30 years (one generation is estimated to be 20 years: Boesch and Boesch-Achermann 2000, Emery Thompson et al. in prep.) and it is suspected that this reduction will continue for the next 30 to 40 years. The maximum population reduction over a three-generation (i.e., 60 year) period from the 1970s to 2030 is suspected to exceed 50%, hence qualifying this taxon for Endangered under criterion A4. The causes of the reduction, although largely understood, have certainly not ceased and are not easily reversible. The suspected future continuation of the population reduction is a precautionary approach based on the rapidly increasing human population density in the region and the high degree of political instability in the range states. P. t. ellioti is the most threatened chimpanzee subspecies, with the smallest distribution and smallest population (estimated total population less than 6,500) and has suffered high rates of decline due to habitat loss. There are no specific conservation measures directed at this subspecies. Although it exists in a number of protected areas, poaching for bushmeat occurs in all of these areas with the exception of Nigeria's Gashaka-Gumti National Park, where that primates are not heavily hunted.

History
  • 2007
    Endangered
  • 2000
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
P. t. ellioti is the least numerous subspecies with a total population of less than 6,500 individuals remaining (B. Morgan and J. Oates pers. comm. 2006). The only relatively large and secure population of P. t. ellioti is in Gashaka-Gumti National Park in Nigeria, with an estimated population of up to 1,500 (Oates et al. 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
See species-level assessment (Pan troglodytes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nigeria-Cameroon chimpanzee

The Nigeria-Cameroon chimpanzee (Pan troglodytes ellioti) is a subspecies of the common chimpanzee which inhabits the rainforests along the border of Nigeria and Cameroon. Male Nigeria-Cameroon chimpanzees can weigh as much as 70 kilos with a body length of up to 1.2 metres and a height of 1.6 metres. Females are significantly smaller.[2]

The Nigeria-Cameroon chimpanzee is recognised as the most threatened and least distributed of all the common chimpanzee subspecies, and without a dramatic change to human behaviour in the area, there is a likelihood of extinction in the coming decades.[3] A June 2008 report said the Edumanom Forest Reserve reserve was the last known site for chimpanzees in the Niger Delta.[4]

References

  1. ^ Oates, J.F., Dunn, A., Greengrass, E. & Morgan, B.J. (2008). Pan troglodytes ssp. ellioti. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 3 February 2012.
  2. ^ Hof, Jutta; Sommer, Volker: Apes Like Us: Portraits of a Kinship, Edition Panorama , Mannheim 2010, ISBN 978-3-89823-435-1, p. 114.
  3. ^ "Chimpanzee Conservation - Cameroon". africanconservation.org. http://www.africanconservation.org/content/view/17/340. Retrieved 2009-10-11.[dead link]
  4. ^ "Nigeria biodiversity and tropical forestry assessment". USAID. June 2008. p. 76. http://pdf.usaid.gov/pdf_docs/PNADN536.pdf. Retrieved 2010-09-18.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!