Articles on this page are available in 1 other language: French (2) (learn more)

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Thymelicus sylvestris

Animal / parasitoid / endoparasitoid
larva of Thecocarcelia acutangula is endoparasitoid of Thymelicus sylvestris

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thymelicus sylvestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thymelicus sylvestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGTACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTAGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCATCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTATATCCTCCTCTTTCATCAAATATTGCTCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCATTATTATTATTACTTTCTTTACCTGTATTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATCTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Small Skipper

The Small Skipper Thymelicus sylvestris butterfly of the Hesperiidae family.

Appearance[edit]

Small Skipper (Germany 2009)

It has a rusty orange colour to the wings, upper body and the tips of the antennae. The body is silvery white below and it has a wingspan of 25–30 mm. This butterfly is very similar in appearance to the Essex Skipper Thymelicus lineola. In the Small Skipper, the undersides of the tips of the antennae are yellow orange, whereas they are black in the Essex Skipper. The black area on the lower edge of the upper wings also differs. Like the other orange 'grass skippers' the male has a distinctive black stripe made up of scent scales.

Distribution[edit]

This butterfly's range includes much of Europe, including Ireland, Britain and Scandinavia, and includes north Africa and the Middle East. It is typically occurring where grass has grown tall.

Lifecycle and foodplants[edit]

Eggs

Eggs are laid loosely inside grass sheathes of the caterpillars foodplants from July to August. The newly hatched caterpillars eat their own eggshell before entering hibernation individually in a protective cocoon of a grass sheath sealed with silk. In the spring the caterpillar begins feeding. The favoured food plant is Yorkshire Fog Holcus lanatus, although other recorded foodplants include Timothy Phleum pratense, Creeping Soft Grass Holcus mollis, False Brome Brachypodium sylvaticum, Meadow Foxtail Alopecurus pratensis and Cock's foot Dactylis glomerata. The caterpillars pupate near the base of the foodplant in June with the first adults on the wing at the end of June, a week or two before the first Essex Skippers.They are strongly attracted to purple flowers such as Thistles and Knapweeds.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!