Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Pamphila pottawattomie Worthington, 1880
Catalog Number: USNM 10261
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Preparation: Pinned
Locality: N. Ind., Indiana, United States
  • Type: Worthington. 1880. Canadian Entomologist. 12: 50.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Generally in more or less wooded countryside in old fields, edges, right of ways, edges of wetlands and other open flowery, grassy situations. Habitat may vary regionally. Not usually seen far from trees.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Pompeius verna in Illinois

Pompeius verna W.H. Edwards: Hesperiidae, Lepidoptera
(observations are from Robertson and Clinebell as indicated below; this skipper is the Little Glassy Wing)

Asclepiadaceae: Asclepias incarnata [plab sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias verticillata [plab sn] (Rb); Asteraceae: Echinacea simulata sn (Cl); Ebenaceae: Diospyros virginiana [stam sn np] [pist sn np] (Rb); Lamiaceae: Blephilia ciliata sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pompeius verna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGCTTATTAATTCGAACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATACTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCCCCATCTTTAACATTATTAATTTCAAGTAGAATTGTAGAAAATGGCGCAGGAACAGGATGAACTGTTTATCCTCCACTATCCTCTAACATTGCTCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCCTTATTATTACTTTTATCATTACCTGTTTTAGCTGGAGCCATTACCATATTATTAACTGATCGAAATTTAAACACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pompeius verna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pompeius verna

The Little Glassywing (Pompeius verna) is a species of butterfly of the Hesperiidae family. It is found from central New England west to central Nebraska, south to northern Florida, the Gulf Coast and southern Texas.[2]

The wingspan is 27-39 mm. Adults preferably feed on the nectar of white, pink and purple flowers, including Apocynum, Prunella, Mentha × piperita, Eutrochium and Asclepias.

The larvae feed on Tridens flavus.

Subspecies

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!