Overview

Comprehensive Description

General Description

This is one of three plain orange skippers in our fauna, with only a small dark stigma dorsally on the males, and without a contrasting wing pattern ventrally. Dorsally, the wing margins are dark, and the darkness extends onto the apices of the wing veins. The wing fringe is orange. Oarisma garita has a white wing fringe, more diffuse dark wing margins dorsally, and light coloured wing veins ventrally. Atrytone logan is larger, with longer antennae, more distinct dark wing margins and dark wing veins dorsally, and a dorsal forewing cell-end bar. As well, note that Thymelicus is more prone to hovering in flight, rather than "skipping" in the fashion of the other two species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This is an introduced European species that most likely spread to North America as overwintering eggs in grass seed, and first detected at London, Ontario, in 1910. It is widely established in eastern Canada and the United States, with isolated colonies in the west, one of which became established in Edmonton in the 1980s and is still spreading outward from that centre.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Open grassy areas, often disturbed, such as roadsides and hay fields.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Like many introduced species quite adaptable, but mostly in highly disturbed non-wetland places such as hayfields.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Grasses, and especially timothy (Phleum pratense).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Thymelicus lineola in Illinois

Thymelicus lineola Ochenheimer: Hesperiidae, Lepidoptera
(observations are from Catling, Stoutamire, Luer, and Small; this is the European Skipper)

Orchidaceae: Calopogon tuberosus exp fq (Lu, Sm), Cypripedium reginae exp np (Stm), Spiranthes lucida sn np (Ct), Spiranthes romanzoffiana sn np (Ct); Rosaceae: Spiraea alba sn (Sm)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Thymelicus lineola

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Thymelicus lineola

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / parasitoid / endoparasitoid
larva of Pseudoperichaeta nigrolineata is endoparasitoid of larva of Thymelicus lineola / sylvestris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Thymelicus lineola is the only species of North American skipper for which eggs are the overwintering stage. There is one brood in Alberta, which begins to emerge in late June.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thymelicus lineola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGTACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCATCTTTAATATTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTATACCCACCTCTTTCTTCTAATATTGCTCACCAAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAGTTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTTGGAATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGAGCAATTACTATACTTCTTACTGATCGAAATTTAAATACTTCTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thymelicus lineola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

As an introduced species, not of concern, although there is some evidence that this species might compete with and affect the behaviour of native Polites spp. in Ontario.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Essex Skipper

The Essex Skipper (Thymelicus lineola) is a butterfly of the Hesperiidae family. In North America, it is known as the European Skipper.

Thymelicus lineola showing black underside to antennae tips

With a wingspan of 2.5 to 2.9 cm it is very similar in appearance to the Small Skipper Thymelicus sylvestris. They can be told apart by the undersides of the tips of the antennae: the Essex skipper's are black whereas those of the Small Skipper are orange. This butterfly occurs throughout much of the Palaearctic region. Its range spreads from southern Scandinavia through Europe to North Africa and east to Central Asia It was only identified in the UK in 1889 and its range is expanding both in England and in northern Europe. In North America, this butterfly was accidentally introduced in 1910 via London, Ontario and has spread across southern Canada[1] and to several northern US states.[2]

Life cycle

Eggs are laid in strings on the stems of grasses where they remain over the winter. The favoured foodplant is Cock's-foot (Dactylis glomerata) and it rarely uses the Small Skipper's favoured foodplant Yorkshire Fog. Other choices include Creeping Soft Grass (Holcus mollis), Couch Grass (Elymus repens), Timothy-grass (Phleum pratense), Meadow Foxtail (Alopecurus pratensis), False Brome (Brachypodium sylvaticum) and Tor-grass (Brachypodium pinnatum). The caterpillars emerge in the spring and feed until June before forming shelters from leaves tied with silk at the base of the foodplant to pupate. The adult flies from July to August. Like most skippers, they are fairly strictly diurnal, though individuals are very rarely encountered during the night.[3]

The egg is pale greenish-yellow, oval in shape, flattened above and below ; the top is slightly depressed.The caterpillar is green, with the incisions between the rings yellowish ; there is a darker green stripe on the back, and the lines on the sides are yellow. The head is pale brown and striped with darker brown. The chrysalis is long, yellowish-green in colour, and retains the dark dorsal stripe seen in the caterpillar.

References

  1. ^ European Skipper, Butterflies of Canada
  2. ^ "European Skipper". Butterflies and Moths of North America. http://www.butterfliesandmoths.org/species?l=2065. Retrieved 14 May 2010.
  3. ^ Fullard, James H. & Napoleone, Nadia (2001): Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera. Animal Behaviour 62(2): 349–368. PDF fulltextdoi:10.1006/anbe.2001.1753
  • Asher, Jim et al.: The Millennium Atlas of Butterflies of Britain and Ireland Oxford University Press
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!