Overview

Brief Summary

North American Ecology (US and Canada)

Hylephila phyleus is a year-round resident in the far southern United States ranging south to Argentina and throughout the Antilles, and introduced to Hawaii in 1970. This species is migratory northward to Ontario and Prince Edward Island in the east, and to Oregon in the west (Scott 1986). Habitats are southern urban lawns and grassy places. Host plants are grasses of several species. Eggs are laid on and around the host plant singly. There are multiple flights all year in southern Florida and southern Texas (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Fiery skippers range in the Nearctic region throughout the southern United States and east toward the Atlantic. They are not found, however, in the Rockies or the Great Basin. Their southern range extends into the Subtropical region to Argentina and the Antilles. In North America, fiery skippers immigrate into northern areas but cannot overwinter in any life stage in regions that have harsh winters.

Biogeographic Regions: nearctic ; neotropical

  • Scott, J. 1986. The Butterflies of North America. Stanford, CA: Stanford University Press.
  • Pyle, M. 1995. National Audubon Society Field Guide to North American Butterflies. NY: Alfred A. Knopf.
  • Iftner, D., J. Shuey, J. Calhoun. 1992. Butterflies and Skippers of Ohio. Columbus, OH: Ohio Biological Survey Bulletin, Vol 9 No.1.
  • Opler, P. 1984. Butterflies East of the Great Plains. Baltimore: John Hopkins University Press.
  • Blue, L., B. Parks. "Fiery Skipper" (On-line ). San Diego Natural History Museum Field Guide. Accessed 06/04/03 at http://www.sdnhm.org/fieldguide/inverts/fieryskipper.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Extremely short antennae distinquish fiery skippers. They are less than 1/2 the length of the forewing. Females are yellowish-brown with small dark spots, males are fiery orange/yellow with a zigzagged border and a large black stigma (a gland used to excrete pheremones) on the forewing. Their wingspans run between 1.0 - 1.25 inches, with the females slightly larger.

The larvae of fiery skippers are tan colored and densely covered with short haris. They have three dark lateral stripes, and a large, dark head that looks segmented from the rest of the body.

The eggs are glossy, and pale turquoise/green and are hemispherically shaped

The chrysalis of fiery skippers are light tan in color with a black dorsal line than runs from end to end.

Range wingspan: 32 to 25 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: In the United States a great variety of open mostly unnatural situations, for example commonly in weedy lawns. Schweitzer noted it as abundant in coastal saline DISTICHLIS meadows in Peru but does not in Jew Jersey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fiery skippers are found most often in open areas, grassy fields, meadows, lawns, and alfalfa and clover fields.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Fiery skipper larvae eat a variety of grasses in the Poaceae family, including bent grass Agrostis, sugar cane Sacchiniarum officinarum, bermuda grass Cynodon dactylon, and St. Augustine grass Stenotaphrum secundatum.

Nectar flowers favored by fiery skippers include red clover Trifolium pratense, alfalfa Medicago sativa, white asters Aster spp., thistles Circium, ironweed Vernonia, knapweed Centaurea, sneezeweed Helenium autumnale, and milkweed Asclepia.

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Hylephila phyleus in Illinois

Hylephila phyleus Drury: Hesperiidae, Lepidoptera
(observations are from Robertson, Clinebell, Fothergill & Vaughn; this is the Fiery Skipper)

Asteraceae: Aster novae-angliae sn (Rb), Aster sagittifolius sn (Rb), Aster subulatus sn (FV), Boltonia asterioides sn (Rb), Echinacea purpurea sn (Cl), Liatris cylindracea sn (Cl), Liatris pycnostachya sn (Cl), Taraxacum officinale sn (FV); Verbenaceae: Phyla lanceolata sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Fiery skippers are minor pollinators and also serve as prey for a variety of predators.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of all life stages of butterflies include a variety of insect parasatoids. These wasps or flies will consume the body fluids first, and then eat the internal organs, ultimately killing the butterfly. Those wasps that lay eggs inside the host body include Ichneumonidae, Braconidae, Pteromalidae, Chalcidoidea, Encyrtidae, Eulophidae, Scelionidae, Trichogrammatidae, and others. Trichogrammatidae live inside the eggs, and are smaller than a pinhead. certain flies (Tachinidae, some Sarcophagida, etc.) produce large eggs and glue them onto the outside of the host. The hatching larvae then burrow into the butterfly larvae. Other flies will lays many small eggs directly on the larval hostplants, and these are ingested by the caterpillars as they feed.

Most predators of butterflies are other insects. Praying mantis, lacewings, ladybird beetles, assasin bugs, carabid beetles, spiders, ants, and wasps (Vespidae, Pompilidae, and others) prey upon the larvae. Adult butterflies are eaten by robber flies, ambush bugs, spiders, dragonflies, ants, wasps (Vespidae and Sphecidae), and tiger beetles. The sundew plant is known to catch some butterflies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Like other butterflies, pheromones are likely important in communication of fiery skippers.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Fiery skippers develop from eggs to larvae, larvae to pupae, and pupae into chrysalis. The adults emerge from the chrysalis and fly off to mate and start the process over again.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male fiery skippers will perch close to the ground on twigs or blades of grass and await females. The fluttering of any winged insect passing by will evoke a response from the waiting males.

In the southern parts of their range, fiery skippers have many broods. If they are able to immigrate into northern areas, they may have a single brood in late summer.

Eggs are laid singly on the undersides of leaves, and occasionally on other plants and objects. Eggs are placed on weedy grasses such as crabgrass Digiteria spp. and Bermuda grass Cynodon dactylon.

Breeding interval: Fiery skippers have several broods throughout the year in the southern portions of their range, and a single brood in the north.

Breeding season: The breeding is year around in the southern parts of the range, and in mid to late summer in the north.

Key Reproductive Features: seasonal breeding ; year-round breeding ; sexual ; fertilization (Internal )

Butterflies are not know to exhibit parental care.

Parental Investment: no parental involvement

  • Scott, J. 1986. The Butterflies of North America. Stanford, CA: Stanford University Press.
  • Opler, P. 1984. Butterflies East of the Great Plains. Baltimore: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hylephila phyleus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hylephila phylaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hylephila phyleus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGATTTTATTCTACTAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGAATACTACCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCTCTATCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCATTATTTGTATGATCTGTAGGTATTACTGCATTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTTTATATTCTTATTTTACCTGGATTTGGTATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGATCTTTAGGTATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGTTGGAATAGATATTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fiery skippers are stable across their range and of no conservation concern at the present time.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fiery skipper larvae are considered lawn pests in some parts of their range.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In regions where fiery skippers are less common, they may attract butterfly enthusiasts who contribute to local economies.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fiery skipper

The Fiery Skipper (Hylephila phyleus) is a butterfly of the family Hesperiidae and are approximately 1 inch (2.5 cm) long. The males are orange or yellow with black spots while the females are dark brown with orange or yellow spots. The caterpillars are greenish pink with a black head. The caterpillars are often considered pests and can feed on bermudagrass, creeping bentgrass, and St. Augustine grass.

Fiery skippers, along with all other species of skippers and skipperlings, can hold their wings in "triangle" shape. The forewings are held upright, and the hindwings are folded flat. This position is thought to better absorb the sun's rays.

The fiery Skipper lives in Northern America.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!