Overview

Comprehensive Description

General Description

This is Alberta's largest skipper; its 44 to 60 mm wingspan, and the large, silver hindwing patch make it very distinctive. The nominate subspecies occurs in Alberta (Bird et al. 1995).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Found throughout most of the continental United States, and in southern Canada west to southern BC (Opler 1999). The northernmost population in North America is associated with patches of the larval hostplant in the North Saskatchewan river valley in Edmonton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

River valleys and badlands in the prairie and parkland region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pretty much any place with lots of the major foodplants which are usually ROBINIA or AMORPHA whether wild or culitvated, native or not. Strays possible in any habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larvae feed on wild licorice (Glycyrrhiza lepidota) in Alberta (Bird et al. 1995). Other legume species have also been reported from the eastern parts of this skipper's range (McCabe & Post 1977, Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Epargyreus clarus in Illinois

Epargyreus clarus Cramer: Hesperiidae, Lepidoptera
(observations are from Robertson, Graenicher, Williams, Reed, Hilty, Hilton Pond Center [HPC], Clinebell, Hapeman, Macior, Luer, Conger, Fothergill & Vaughn; this is the Silver-Spotted Skipper)

Acanthaceae: Justicia americana sn (Rb); Apocynaceae: Apocynum cannabinum [unsp sn] (H); Asclepiadaceae: Asclepias incarnata [plab sn] (Rb), Asclepias sullivanti [plpr sn] (Rb), Asclepias syriaca [plab sn] (Rb); Asteraceae: Arctium lappa sn (Gr), Aster pilosus sn (Rb), Bidens aristosa sn (Rb), Cirsium arvense sn (Gr), Echinacea pallida sn (Cl), Echinacea purpurea sn (Cl), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn (Rb), Liatris aspera sn (Cl), Liatris cylindracea sn (Cl), Liatris pycnostachya sn (Rb, Cl), Pluchea camphorata sn (FV), Silphium perfoliatum sn (Rb), Vernonia fasciculata sn (Rb); Boraginaceae: Onosmodium molle sn (Wm); Brassicaceae: Cardamine bulbosa sn (Rb); Convolvulaceae: Ipomoea lacunosa sn (FV); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Melilotus alba sn (Rb), Orbexilum onobrychis sn (Rb), Trifolium pratense sn fq (Rb), Trifolium repens sn (Rb, FV); Hydrangeaceae: Hydrangea arborescens sn (Rb); Lamiaceae: Agastache foeniculum sn (Re), Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa sn fq (Rb, Re, Cl), Nepeta cataria sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn (Rb), Salvia azurea sn np (H), Scutellaria incana sn np (Rb), Teucrium canadense sn (Cng); Orchidaceae: Platanthera peramoena sn (Hpm, Lu); Philadelphaceae: Philadelphus grandiflorus sn (Rb); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Phlox pilosa sn (Rb); Pontederiaceae: Pontederia cordata sn (HPC); Ranunculaceae: Delphinium tricorne sn fq np (Rb, Mc); Rosaceae: Rubus allegheniensis sn (Rb), Rubus flagellaris sn (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb); Scrophulariaceae: Mimulus ringens sn np (Cng), Veronicastrum virginicum sn (Cl); Verbenaceae: Verbena hastata sn (Rb, Cng), Verbena simplex sn (Rb), Verbena stricta sn fq (Rb); Violaceae: Viola sororia sn (FV)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are most often encountered between late June and early July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

There is one yearly brood, and mature larvae are green with black bands and a dark brown head. Larvae construct shelters out of the host plant leaves, at first cutting and folding part of the leaf over them, but tying several leaves together as larvae grow larger (McCabe & Post 1977). Pupae hibernate in leaf nests near the ground, often on the foodplant itself (Layberry et al. 1998). The egg is greenish and round. Males are aggressive fliers, and often chase one another (Bird et al. 1995). The Silver-spotted skipper is uncommon in Alberta, and occurs in local colonies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epargyreus clarus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGGTTAATTCCCCTTATATTAGGGGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTCTTTCTTCCAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACAGCTTTATTATTATTACTTTCCTTACCCGTATTAGCTGGTGCTATTACCATATTATTAACTGATCGAAATTTAAATACCTCTTTCTTTGATCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epargyreus clarus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

May be sensitive to valley flooding, but currently secure.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Epargyreus clarus

The Silver-spotted Skipper (Epargyreus clarus) is a butterfly of the family Hesperiidae. It is claimed to be the most recognized skipper in North America.[1]

Description[edit]

The wingspan of an adult is 43–67 mm. The adult has translucent gold spots on the forewings and silvery bands on the hindwings.[2]

The caterpillar's head is large and brown with two orange dots mimicking eyes. It has a long, narrow, green body.

Life cycle[edit]

The adult Silver-spotted skipper occurs in fields, gardens and at forest edges. It ranges from southern Canada throughout most of the United States to northern Mexico; it is absent in the Great Basin and western Texas.[2]

Adults fly throughout the warm part of the year. They have one brood per year in the North and West, two in the East, and three or four in the Deep South.[2]

Females lay single eggs on the caterpillars' host plants.Young caterpillars fold leaves to make shelters, and older ones stick leaves together with silk.[2] They overwinter as chrysalids.

Larval foods[edit]

Pinned E. clarus

The larvae feed on legumes, many trees and shrubs but also some herbaceous plants. Their hosts include:

Nectar flowers[edit]

Adults almost never feed on yellow flowers.[2] Among their favorites are:

References[edit]

  1. ^ Kaufman, Kenn; Eaton, Eric R. Kaufman Field Guide to Insects of North America. Houghton Mifflin Books. pp. 236–237. ISBN 978-0-618-15310-7. 
  2. ^ a b c d e "Silver-spotted skipper". Butterflies and Moths of North America. Retrieved 2008-10-11. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!