Overview

Brief Summary

North American Ecology (US and Canada)

Polites peckius is a year-round resident from Alberta and eastern Washington eastward across southern Canada and the northern United States, and in a few separate populations in the White Mountains, Arizona and in Colorado (Scott 1986). Habitats are meadows and prairie. Host plants are grasses, with known hosts Leersia oryzoides, Poa pratensis. Individuals overwinter as larvae and pupae. There is one flight each year in the northern part of their range with the approximate flight time July 1-July 31, and two flights elsewhere between late May-June 15 and late July ? Sept. 15(Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

The Hobomok Skipper (Poanes hobomok) is the only other skipper that shares the large, brown-bordered yellowish patch on the hindwing underside; in Peck's, this patch is separated into two areas by a median dark patch, and in Hobomok the pale patch is continuous throughout the median area. Males of these two species can also be separated by the presence of the prominent black dash on the forewing of P. peckius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Peck's Skipper is primarily a species of east-central North America, ranging from eastern B.C. and northern Alberta east to Labrador, south to Georgia and northern Texas (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Peck's skippers are found in the Nearctic range, and extend from Nova Scotia to British Columbia in southern Canada. Their range extends southward from northern Oregon, southern Colorado, northwest Arkansas, to northern Georgia. They are rare in the south.

Biogeographic Regions: nearctic (Native )

  • Klots, A. 1951. A Field Guide to the Butterflies of North American, East of the Great Plains. Boston: Houghton Mifflin Company.
  • Scott, J. 1986. The Butterflies of North American. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Peck's skippers are also known as yellow patch skippers because of the light colored post median spot bands on the underside of the forewings. The central spot is elongated and extends out toward the wing margin. Males have a dark black stigma on the upper surface of the forewing that separates the orange margin from the darker portion of the wing. These are small skippers, with the forewing lengths of females averaging 1.3 cm (1.2-1.4 cm). Males are slightly smaller with forewing lengths of 1.2 cm (1.1-1.3 cm).

Larvae are deep maroon colored with light brown mottling. The head is black with two white vertical streaks on the upper front and two white patches below.

The eggs of Peck's skippers are cream colored and develop reddish mottling in irregular patterns.

The chrysalis is reddish purple with white wing cases.

Range wingspan: 2.2 to 2.5 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Opler, P., G. Krizek. 1984. Butterflies East of the Great Plains. Baltimore: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Moist meadows, ditches and fens throughout the province.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These grassland skippers prefer open areas with ample nectar sources, such as meadows, powerline right-of-ways, prairies, parks and vacant lots.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

  • Shapiro, A. 1966. Butterflies of the Delaware Valley. American Entomological Society Special Publication.
  • Glassberg, J. 1999. Butterflies Through Binoculars: the East. NY: Oxford University Press.
  • Struttman, J. "Butterflies of Pennsylvania Peck's Skipper <> (=<>)" (On-line ). Butterflies of North America. Accessed 06/21/03 at http://www.npwrc.usgs.gov/resource/distr/lepid/bflyusa/pa/548.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: A variety of mostly disturbed grasslands such as hayfields, pastures, old fields, right of ways, eastward; also mountain meadows and prairies as well as disturbed places westward. Most habitats are more or less mesic but also at least around the edges of wetlands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Larvae feed on Rice Cutgrass (Leersia oryzoides) in Manitoba (Layberry et al. 1998). Adults take nectar at flowering legumes, and are particularly fond of alfalfa (Medicago sativa) (Hooper 1973).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The larvae feed primarilly on rice cutgrass (Leersia oryzoides) and bluegrass (Poa pratensis), although other grasses are probably used.

Adults have been recorded nectaring on clover (Trifolium spp.), alfalfa (Medcago sativa), winter cress (Bararea vulgaris), joe-pye weed (Eupatorium maculatum), teasel (Dipsacus sylvestis), thistle (Cirsium spp.), purple coneflower (Echinacae purpurea), ironweed (Vernonia spp.), and blazing star (Liatris spicata). They have also been seen sipping from mud and moist soil.

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Polites peckius in Illinois

Polites peckius Kirby: Hesperiidae, Lepidoptera
(observations are from Robertson, Graenicher, Hilty, Reed, and Clinebell; this is Peck's Skipper; another scientific name for this species is Polites coras Cramer)

Apiaceae: Eryngium yuccifolium sn (Rb), Heracleum maximum sn (Rb); Asclepiadaceae: Asclepias incarnata [plab sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias sullivanti dead (Rb), Asclepias syriaca [plab sn] (Rb), Asclepias verticillata [plpr sn] (Rb); Asteraceae: Arctium lappa sn (Gr), Aster laevis sn (Gr, H), Aster lanceolatus sn (Rb), Aster novae-angliae sn (Rb, Gr), Aster oolentangiensis sn (H), Aster pilosus sn (Rb), Boltonia asterioides sn (Rb), Cirsium hillii sn (Rb), Cirsium vulgare sn (Rb, Gr), Conoclinium coelestinum sn (Rb), Echinacea pallida sn (Rb), Echinacea purpurea sn (Cl), Erigeron philadelphicus sn (Rb, Gr), Eupatoriadelphus purpureus sn (Rb), Eupatorium altissimum sn (Rb, H), Euthamia graminifolia sn (Rb), Krigia biflora sn (Rb), Liatris aspera sn (Rb, H, Cl), Liatris pycnostachya sn fq (Rb, Cl), Liatris spicata sn (Gr), Oligoneuron rigidum sn (Rb, H), Rudbeckia triloba sn (Rb), Tanacetum vulgare sn (Gr), Vernonia fasciculata sn (Rb); Brassicaceae: Capsella bursa-pastoris sn (Rb); Campanulaceae: Lobelia spicata sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Dalea purpurea sn (Rb), Trifolium pratense sn (Rb), Trifolium repens sn (Rb); Iridaceae: Iris versicolor shrevei sn np (Rb); Lamiceae: Blephilia hirsuta sn (Rb), Glechoma hederacea sn np (Rb), Monarda fistulosa (Cl), Prunella vulgaris sn (Rb), Pycnanthemum tenuifolium sn (Rb), Salvia azurea sn np (H), Scutellaria parvula sn np (Rb), Teucrium canadense sn (Rb); Lythraceae: Lythrum alatum sn fq (Rb); Onagraceae: Oenothera pilosella sn (Rb); Polemoniaceae: Phlox glaberrima sn (Rb), Phlox pilosa sn (Rb); Rosaceae: Rubus allegheniensis sn (Rb), Rubus occidentalis sn (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb), Houstonia lanceolata sn (Rb); Scrophulariaceae: Penstemon grandiflorus sn np (Re); Verbenaceae: Phyla lanceolata sn (Rb), Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Peck's skippers serve as minor pollinators and as prey for a variety of predators.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of all life stages of butterflies include a variety of insect parasatoids. These wasps or flies will consume the body fluids first, and then eat the internal organs, ultimately killing the butterfly. Those wasps that lay eggs inside the host body include species in many different groups: Ichneumonidae, Braconidae, Pteromalidae, Chalcidoidea, Encyrtidae, Eulophidae, Scelionidae, Trichogrammatidae, and others. Trichogrammatids live inside the eggs, and are smaller than a pinhead. Certain flies (Tachinidae, some Sarcophagidae, etc.) produce large eggs and glue them onto the outside of the host larva, where the hatching fly larvae then burrow into the butterfly larvae. Other flies will lays many small eggs directly on the larval hostplants, and these are ingested by the caterpillars as they feed.

Most predators of butterflies are other insects. Praying mantis, lacewings, ladybird beetles, assasin bugs, carabid beetles, spiders, ants, and wasps (Vespidae, Pompilidae, and others) prey upon the larvae. Adult butterflies are eaten by robber flies, ambush bugs, spiders, dragonflies, ants, wasps (Vespidae and Sphecidae), and tiger beetles. The sundew plant is known to catch some butterflies.

There are also many vertebrate predators including lizards, frogs, toads, birds, mice, and other rodents.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Butterflies generally communicate through visual or pheremone recognition, or by tactile methods during courthship.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Most common in July; one brood per year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The description of the immature stages is summarized by Guppy & Sheppard (2001) as follows: The egg is pale green and round, mature larvae are dark maroon with light mottling and covered in dark hairs. This is presumed to be the overwintering stage. The reddish purple pupa is formed in a loose cocoon made within a bent blade of grass. It is generally considered to be a prairie / parkland species in the prairie provinces (Hooper 1973, Bird et al. 1995), but it also occurs locally in sedge marshes of the boreal forest north to at least La Butte Creek on the Slave River (Macaulay & Pohl 2002). Peck's Skipper also colonizes man-made, grassy habitats in the northern boreal parts of its range (Hooper 1973, Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Peck's skippers have the ability to transform straight to the adult form of the next brood or slow down their growth and hibernate as 3rd, 4th, or 5th stage larvae. They are also reported to hibernate as pupae.

Development - Life Cycle: metamorphosis ; diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male Peck's skippers perch on low vegetation in sunny areas to await females. Courtship activities occur throughout the day. Mated pairs are observed mainly in the afternoon.

Peck's skippers have two broods in the north and three in the southern portion of their range. Females lay their eggs singly on appropriate substrate.

Breeding interval: Peck's skippers have two broods in the north and three in the southern portion of their range.

Breeding season: The flight period ranges from May through October.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

There is no parental care provided by butterflies.

Parental Investment: no parental involvement

  • Opler, P., G. Krizek. 1984. Butterflies East of the Great Plains. Baltimore: John Hopkins University Press.
  • Scott, J. 1986. The Butterflies of North American. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polites peckius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGTTTACTGATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGAATATTACCCCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGACCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTATTGTTACTCTTATCTTTGCCTGTTTTAGCAGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Polites peckius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Peck's skippers appear to be secure across their range and are not of conservation concern at this time.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Peck's skippers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Peck's skippers provide enjoyment to butterfly watchers and thus provide economic benefits in the form of ecotourism.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Polites peckius

The Peck's Skipper (Polites peckius) is a North American butterfly in the family Hesperiidae (skippers), subfamily Hesperiinae (grass skippers). This skipper ranges across Canada from British Columbia, as far north as Cartwright, Labrador; Moar Lake, Ontario; Leaf Rapids, Manitoba; and the Hay River area in Alberta. In the US, it ranges in most of the northern and central states, except on the west coast.

Contents

Description

Both sexes have dark brown and yellowish-orange markings. Ventrally, both sexes have a large straw-coloured patch in the middle of the hindwing. This patch helps distinguish it from other Polites.[1] Like other skippers the ends of the antennae have tiny hooks. Wingspan is from 19 to 27 mm.

Behaviour

Flies from June through early August on flowers, at roadsides, wet meadows, and in gardens.

References

  1. ^ Peck's Skipper, Butterflies of Canada
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!