Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Resident in southern Southwest in North America with a large migratory expansion range through central North America (Scott 1986). Habitats are OPEN AREAS. Host plants are herb and tree with most known hosts largely restricted to a few species in one family, Leguminosae. There are multiple flights each year with the approximate flight time APR1-NOV30 in the northern part of the range and year round in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from southern California to Louisiana. Emigrates north as far as Ontario. Also occurs south to Central America. May appear to be permanent in areas in which it is actually a very regular migrant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Open oak woods, meadows in pine forest, mountain canyons, desert scrub, dry flats. Larval hosts are in genus Cassia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurema mexicana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGGACAGAATTAGGTAATCCTGGATCATTAATTGGTGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGACATAGCATTTCCCCGTATAAATAATATAAGTTTTTGATTACTACCCCCTTCATTAACTCTTTTAATTTCTAGAAGTATTGTTGAAAACGGAGCAGGTACAGGATGAACAGTTTACCCCCCTCTTTCATCTAATATCGCTCACAGAGGTTCATCAGTAGATTTAGCTATTTTCTCATTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAGTATATCATTTGACCAAATACCTCTATTTATTTGAGCAGTAGGGATTACTGCGTTACTTTTATTACTTTCATTACCAGTTTTAGCCGGAGCTATTACAATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGGCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGTATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGTTCATTAGGTATAATTTATGCAATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCCCACCATATATTTACAGTAGGAATAGATATTGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurema mexicana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Resident in arid southwest U.S.; common in Mexico and Central America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurema mexicana

The Mexican Yellow (Eurema mexicana, sometimes called the Wolf-Face Sulphur[2]) is a North and South American butterfly in the family Pieridae. It occurs mainly in Mexico but occasionally is found in central and southwestern USA and rarely in Canada.[3]

Contents

Description

Underside of summer form
Underside of winter form

The upper side of the wings is pale yellow with a black fore wing submarginal border outlining a "dog" or "wolf-face" pattern. The hind wing has a small outer margin black border. The male has a bright yellow patch on the leading edge of the hind wing. The underside of the wings is pale yellow in summer individuals and pale yellow with reddish markings or all reddish-pink in winter individuals. The hind wing is sharply pointed.[4] The wingspan measures 1¼ to 2¼ inches[5] or 33-44 mm.[3]

Similar species

Similar species in the Mexican Yellow's range include Boisduval's Yellow (Eurema boisduvaliana) and the Salome Yellow (Eurema salome).

Boisduval's Yellow is smaller and brighter yellow, the male has a weaker "dog face" pattern, the female has reduced black on the upper side, and the hind wing is less sharply pointed.[4]

The Salome Yellow is brighter yellow, has more limited black on the upper side, and the underside of the hind wing has a round reddish spot near the trailing edge.[4]

Habitat

The Mexican Yellow lives in a variety of open habitats such as woodland edges, open woodlands, and desert grasslands.[2][5][6]

Flight

This butterfly may be seen almost all year in Arizona and Texas, and April to November in New Mexico. It strays northward in late summer, rarely reaching Canada.[2][4][5]

Life cycle

Males will patrol all day looking for females.[2] The larva is green with a middorsal creamy or yellow stripe and a lateral yellow stripe.[6] The Mexican Yellow has 3-4 broods per year.[4]

Host plants

Here is a list of host plants used by the Mexican Yellow:

References

  1. ^ Gerardo Lamas (edited by) (2004). Atlas of Neotropical Lepidoptera. Checklist: Part4A. Hesperioidea-Papilionoidea. Scientific Publishers, Inc., Gainesville, FL. ISBN 0-945417-28-4
  2. ^ a b c d James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, CA. ISBN 0-8047-2013-4
  3. ^ a b Mexican Yellow, Butterflies of Canada
  4. ^ a b c d e Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0-618-15312-8
  5. ^ a b c Bob Stewart, Priscilla Brodkin and Hank Brodkin (2001). Butterflies of Arizona. West Coast Lady Press. ISBN 0-9663072-1-6
  6. ^ a b Thomas J. Allen, Jim P. Brock and Jeffrey Glassberg (2005). Caterpillars in the Field and Garden. Oxford University Press, New York, NY. ISBN 978-0-19-514987-6
  7. ^ Eurema, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!