Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

General Description

Superficially similar to the other checkered skippers, but communis can immediately be separated by its large white markings (more white than black), and the paler, chalky underside. This skipper and the Small Checkered Skipper (P. scriptura) are the only Pyrgus skippers likely to be encountered in the prairie grasslands. These two can easily be separated by the broader white markings and larger size of P. communis (wingspan 25- 30 mm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Occurs throughout most the contiguous United States, except southern Florida, California, Arizona and Texas (Opler 1999). In Canada, the Common Checkered Skipper occurs from southeastern BC to southern Manitoba, and extreme southern Ontario (Layberry et al 1998). The northernmost portion of its range is the disjunct population in the Peace River grasslands; there is also an isolated record from the vicinity of Ft. MacKay (Bird et al. 1995).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Prairie grassland, also occasionally found in boreal sand dunes and the aspen parkland.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: A generally transient species in a great variety of dry disturbed situations and some more natural ones such as short grass prairies. Low vegetation, flowers, and patches of bare ground are probably important. Strays can turn up in almost any open situation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larval foodplant is unknown in Alberta; mallows (Malva and Sphaeralcea) have been reported as hosts elsewhere (Layberry et al. 1998). The only native mallow that occurs throughout the province in suitable habitat is Scarlet Mallow (Sphaeralcea coccina) (Moss 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Pyrgus communis in Illinois

Pyrgus communis Grote: Hesperiidae, Lepidoptera
(observations are from Robertson; this is the Common Checkered Skipper)

Asteraceae: Arctium minus sn (Rb), Aster sagittifolius sn (Rb); Malvaceae: Sida spinosa sn (Rb); Verbenaceae: Verbena bracteata sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Two broods, the first appearing in June and the second in August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The egg is pale green (Bird et al. 1995). The larvae, which overwinter when mature, vary in colour from yellowish white to brown, with a dark dorsal and brown and white lateral stripes (Layberry et al. 1998). The body tapers towards the posterior (thickest in the middle) and is thickly covered with short whitish hairs; the head and first thoracic segment is blrown-black (McCabe & Post 1977). The pupae are brown, with some green towards the head (Bird et al. 1995). Adults prefer sparsely vegetated areas and will often land on bare ground, and males will set up and patrol small territories (McCabe & Post 1977). Opler (1999) indicates our populations may be the result of periodic colonizations, but all evidence suggests that Peace River and prairie populations are breeding residents.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyrgus communis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCTACTAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTATAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGCTCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTCTTATTTTACCAGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGCTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pyrgus communis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 69
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pyrgus communis

The Common Checkered-skipper (Pyrgus communis) is a species of butterfly in the Hesperiidae family. It is known as the frequently seen Pyrginae species in the northern United States by collectors and watchers alike.[2]

Description[edit]

The common checkered-skipper has a wingspan of 19 to 32 mm. It gets its name from the checkerboard pattern on its wings; the male tends to have broader bands than the female. The body tends to be blue-gray with the small amount of "fuzz" which is seen in all skippers.

Distribution[edit]

This butterfly flies in gardens, parks, fields, roadsides, riverbanks, lowlands and foothills throughout southern Canada and almost the entire expanse of the United States. It has also been seen in Mexico.

Life cycle[edit]

The eggs are small and round, about 0.5 mm in diameter, and are a pale-green color. They are usually laid singly on tender parts of their host plant. The caterpillar has a black head and greenish-tan body. It has a dark line along its back and tends to be paler on the sides.

In southern regions this species will fly all year with multiple broods. In the north it will have two broods and fly late into the fall.

Larval foods[edit]

Images[edit]

References[edit]

  1. ^ a b "Species Pyrgus communis - Common Checkered Skipper". Retrieved 29 September 2009. 
  2. ^ Kaufman, Kenn; Eaton, Eric R. Kaufman Field Guide to Insects of North America. Houghton Mifflin Company. pp. 236–237. ISBN 978-0-618-15310-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!