Overview

Brief Summary

North American Ecology (US and Canada)

Lerema accius is a year-round resident of the southwestern United States, and is migratory northward into New England, as far north as Iowa, and into southern Arizona and New Mexico from Mexico (Scott 1986). Habitats are grassy fields and open woods. Host plants are multiple species of grasses. There are multiple flights all year is southern Florida and Texas, Feb.1-Nov.30 on the Gulf Coast (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Many sorts of grassy habitats, usually disturbed but can be more natural. Commonly seen during migrations in gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lerema accius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATCTTCGGAATTTGAGCTGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTACCCTCCATTATCCTCAAATATTGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATCTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTTAGAAATTTATCTTTTGATCAAATACCTTTATTCGTTTGATCTGTAGGAATTACTGCACTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lerema accius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lerema accius

The Clouded Skipper (Lerema accius) is a butterfly of the Hesperiidae family. It is found in the United States from Georgia west to Texas, south to Florida, and south through Mexico and Central America to Venezuela and Colombia.

The wingspan is 32–45 mm. Adults are on wing year round in Florida and southern Texas.

The larvae feed on various grasses including Stenotaphrum secundatum, Erianthus alopecturoides and Echinochloa povietianum. Adults feed on the nectar of various pink, purple, or white flowers, including shepherd's needle, selfheal, vervain, buttonbush, and lantana.

Subspecies

Photos

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!