Overview

Brief Summary

Introduction

This species is widespread in the eastern U. S.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: From about extreme southern New Jersey southward, almost any kind of forest, woodland, edge or other habitat with oaks and adequate nectar for both broods, including suburban situations. Absent or nearly so from areas such as the pristine sections of the New Jersey Pine Barrens and some xeric southeastern pinelands that lack summer nectar. It is more restricted to xeric rocky areas and barrens north of southern New Jersey. Oak woodlands westward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Erynnis horatius in Illinois

Erynnis horatius Scudder & Burgess: Hesperiidae, Lepidoptera
(observations are from Clinebell, Fothergill & Vaughn; this skipper is Horace's Duskywing)

Asteraceae: Echinacea purpurea sn (Cl), Senecio glabellus sn (FV), Taraxacum officinale sn (FV); Fabaceae: Trifolium repens sn (FV)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erynnis horatius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCCGGTTCTTTAATTGGAGATGATCAAATCTATAATACTATTGTCACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGTGCTGGTACTGGATGAACTGTATATCCCCCCCTTTCAGCTAATATTGCACACCAAGGCTCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCCGGTATTTCATCAATTCTAGGAGCTATTAATTTTATTACAACTATTATCAACATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTCGTGTGAGCCGTAGGTATTACCGCTTTACTATTATTATTATCCTTACCAGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCAGCAGGAGGGGGAGATCCCATTCTTTACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erynnis horatius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Erynnis horatius

Horace's Duskywing (Erynnis horatius) is a butterfly of the Hesperiidae family. It is found from Massachusetts, west to eastern South Dakota, south through most of the eastern United States to Florida, the Gulf Coast, and southern Texas, south in the west through south-eastern Utah, Colorado, north-eastern Arizona, and New Mexico. Fringes are brown. Upperside of male forewing is dark brown with little contrast and no white overscaling. Upperside of female forewing is light brown with a contrasting pattern and large transparent spots. Underside of hindwing is usually without 2 spots below the apex. The male has a costal fold containing yellow scent scales; the female has a patch of scent scales on the 7th abdominal segment.

The wingspan is 36–49 mm. There are two generations in the north, with adults on the wing from April to September; there are three generations in the deep south and Texas, with adults on the wing from January to November. Adults prefer open woodlands and edges, clearings, fencerows, wooded swamps, power-line right-of-ways, open fields, and roadsides

The larvae feed on young leaves of red and white oaks, including Quercus phellos, Quercus velutina, Quercus ilicifolia, Quercus nigra, Quercus stellata, and Quercus virginiana. Adults feed on various flowers of plants up to about 4.5 feet tall, including dogbane, buttonbush, sneezeweed, goldenrod, peppermint, boneset, and winter cress.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!