Overview

Brief Summary

North American Ecology (US and Canada)

Resident in western North America (Scott 1986). Habitats are CONIFEROUS FOREST. Host plants are usually trees with known hosts largely restricted to a few species in one family, Pinaceae. Eggs are laid on the host plant in rows of 3-22 eggs. Individuals overwinter as eggs. There is one flight each year with the approximate flight time JUL15-SEP15 depending on latitude (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

No other white has the black leading forewing edge, joined to the black mark at the end of the discal cell. Of the described subspecies, Canadian populations have been assigned to menapia (Bird et al. 1995, Layberry et al. 1998), but more recent treatments suggest the most appropriate name for our populations is tau (Austin 1998, Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern half of BC south to California and New Mexico (Opler1999). There are only a few records for Alberta, all originating prior to 1923 from the Banff area (Bird et al. 1995). It is possible that these specimens represent occasional strays from adjacent areas of BC, and that this is not a resident species in Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern British Columbia south in woodlands to southern California; from Alberta south in Rocky Mountains into Mexico. Also in South Dakota, Nebraska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Dry, montane woodlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pine forests in most of range. In northern coastal California Douglas fir forests from sea level to mid-montane. Larvae feed on various conifers but mainly on ponderosa pine in most places

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

No information is available for Alberta populations. In BC, larvae feed on conifers in the Pinaceae, including Amabilis fir, Douglas-fir, lodgepole-, white- and ponderosa pine, and western hemlock (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

feed mainly from nectar. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

One Annual brood, flying in August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The eggs overwinter after they are laid at the base of conifer needle clumps. They are bright green and flask-shaped with longitudinal ridges (Guppy & Shepard 2001). Mature larvae are dark green with a white dorsal and lateral stripe, and have short tails a t the posterior end (Guppy & Shepard 2001). The Pine White has occasional population outbreaks, and larvae can cause severe defoliation of conifers (Guppy & Shepard 2001). Adults spend a good deal of time among the uppermost branches of conifers, and descend to nectar at flowers, particularly in the morning and evening (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neophasia menapia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCATTAATCCTCCTTATCTCCAGAAGACTAGTAGAAACCGGTGCTGGGACAGGTTGAACAATTTACCCTCCTTTATCTTCCAATTTAGCTCATAGTGGTTCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCGATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATAATATTTGATCAAATACCACTTTTCGTTTGATCAGTAGGTATCACAGCTTTACTTCTTTTACTGTCTTTACCAGTTCTTGCAGGAGCAATTACAATATTATTAACAGATCGAAATTTAAATACATCCTTTTTCGACCCTGCAGGAGGTGGAGACCCAATTCTTTATCAACACTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTGCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATCTTTAGGAATAATTTACGCTATAATAGCAATTGGATTATTAGGATTTATTGTCTGAGCCCACCATATATTTACTGTTGGAATAGATATTGACACTCGAGCTTATTTTACTTCAGCAACAATAATTATTGCTGTTCCCACAGGAATTAAAATTTTTAGCTGATTAGCAACTCTTTATGGAACT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neophasia menapia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Undetermined status, likely an occasional stray.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Common, widespread, no threats known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None, an occasional economic pest of ponderosa pine forests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Neophasia menapia

The Pine White (Neophasia menapia) is a butterfly in the family Pieridae. It is found in western USA and in southern British Columbia.[1][2]

It is mostly white with black vines and wing bars. Similar to Neophasia terlooii but ranges only overlap in New Mexico.[1][2]

The wingspan is 42 to 50 millimeters.[1]

The host plants are Pinus sp., Pseudotsuga menziesii, Tsuga heterophylla, Abies balsamea, Abies grandis, and Picea sitchensis.[3]

References[edit]

  1. ^ a b c Pine White, Butterflies of Canada
  2. ^ a b Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0618153128
  3. ^ Neophasia, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!