Overview

Brief Summary

North American Ecology (US and Canada)

Atalopedes campestrisis resident all year in the far southern United States ranging south to Brazil and in a separate population in central California. This species migrates northward as far as Ontario and North Dakota (Scott 1986). Habitats are subtropical to transition zone grassy areas and lawns. Host plants are grasses, including the following species: Cynodon dactylon, Festuca rubra, Stenotaphrum secundatum, Digitaria sanguinalis, Eleusine indica. Eggs are laid on or near the host plant singly. There are multiple flights all year in southern Florida and Texas, late April- early Oct. in lowland California, and April 1-Nov. 30 in the southeastern U.S. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Virtually any kind of dry grassland, especially weedy lawns and disturbed dry places. Adults commonly seen in gardens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Atalopedes campestris in Illinois

Atalopedes campestris Boisduval: Hesperiidae, Lepidoptera
(observations are from Robertson, Clinebell, and Estes & Thorp; this skipper is the Sachem)

Asteraceae: Aster lanceolatus sn (Rb), Aster pilosus sn fq (Rb), Aster salicifolius sn (Rb), Aster turbinellus sn (Rb), Bidens cernua sn (Rb), Eupatorium serotinum sn (Rb), Liatris aspera sn (Cl), Liatris cylindracea sn fq (Cl), Liatris pycnostachya sn (Cl), Pseudognaphalium obtusifolium sn (Rb); Lamiaceae: Monarda fistulosa (Cl); Onagraceae: Ludwigia peploides glabrescens sn np (ET); Rubiaceae: Cephalanthus occidentalis sn (Rb); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Atalopedes campestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATACTTTATTTTTGGTATTTGAGCCGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAACAGAACTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCAAACATTGCTCATCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTACTATTATTGTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Atalopedes campestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atalopedes campestris

Atalopedes campestris (called the Sachem in the United States) is a small skipper. It is just over 1 inch long and is orange and brown. Females are slightly larger and have paler markings on the wings.

Contents

Life cycle

Its host plants are various grasses, including lawn grasses. The caterpillar is dark green and black. It has multiple broods per year.

Range and habitat

This skipper is common from the southern United States to Brazil. It often ranges north to the northern states.

Photos

References

Tveten, Gloria and Tveten, John. Butterflies of Houston & Southeast Texas. University of Texas Press, ISBN 0-292-78060-5

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!