Overview

Comprehensive Description

Biology

The depth range of this species is not well defined; specimens observed at fish marketswere presumably caught by longline fishers operating in deeper parts of the continental shelf. It probably prefers deeper colder water with a single shallow water observation from the eastcoast of Bali where cold-water upwelling is common. All males (n = 43) mature by ca 90 cm TL; smallest mature female recorded at 94 cm TL, two pregnant females recorded at 104 and 108 cm TL, smaller of the two pregnant females contained 4 mid-term embryos between 13 and 14 cm TL (Ref. 84278).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Indonesia (Ref. 84278); also from off Sarawak Malaysian (Borneo), unconfirmed records from Taiwan (Penghu Islands), and the Philippines (Visayas and Cebu City), Ryukyu Islands (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

112 cm TL (male/unsexed; (Ref. 84278)); 120 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This medium-sized (to at least 120 cm TL) Orectolobus species is distinguished by the following set of characters: coloration complex and variable, strongly vermiculate over dorsal and lateral surfaces with alternating dark brownish bars and saddles; dorsal and upper surface of paired fins with prominent vermicular patterns; ventral surface of trunk mainly uniformly pale; nasal barbel with a branch; preorbital dermal lobes complex, with 2-3 simple lobes in PO1 group and 3-4 simple to terminally branched lobes in PO2; simple postspiracular dermal lobes, well- developed, thallate, distance across preorbital group 1.3-1.6 times interspace between preorbital group and postspiracular lobe (PO/PO-PS1), 6.5-8.0 times base length of anterior postspiracular lobe (PO/PS1); base of anterior postspiracular lobe 4.3-5.3 in its distance from postorbital group (PO-PS1/PS1), 2.5-2.9 in its distance from posterior postspiracular lobe (PS1-PS2/PS1); enlarged supraocular knob or warty tubercles on back absent; dorsal fins tall, upright; first dorsal-fin origin near insertion of pelvic fin; tip of pelvic fin below insertion of first dorsal fin; interdorsal space 0.5-0.8 times anal-fin base length; anal-fin inner margin 0.7-0.8 of anal-fin posterior margin; 23 tooth rows in upper jaw, rudimentary row of teeth at symphysis of upper jaw usually present; monospondylous centra 44-51; total vertebral centra about 148-163 (Ref. 84278).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus leptolineatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTTCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCTCACGCCGGATCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAATCCTTCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus leptolineatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!