Overview

Comprehensive Description

Biology

The depth range of this species is not well defined; specimens observed at fish marketswere presumably caught by longline fishers operating in deeper parts of the continental shelf. It probably prefers deeper colder water with a single shallow water observation from the eastcoast of Bali where cold-water upwelling is common. All males (n = 43) mature by ca 90 cm TL; smallest mature female recorded at 94 cm TL, two pregnant females recorded at 104 and 108 cm TL, smaller of the two pregnant females contained 4 mid-term embryos between 13 and 14 cm TL (Ref. 84278).
  • Last, P.R., J.J. Pogonoski and W.T. White 2010 A new wobbegong shark, Orectolobus leptolineatus sp. nov. (Orectolobiformes: Orectolobidae), from the Western Central Pacific. 1-16 pp. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of new sharks and rays from Borneo. CSIRO Marine and Atmospheric Research Paper no. 32. (Ref. 84278)   http://www.fishbase.org/references/FBRefSummary.php?id=84278&speccode=65548 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Indonesia (Ref. 84278); also from off Sarawak Malaysian (Borneo), unconfirmed records from Taiwan (Penghu Islands), and the Philippines (Visayas and Cebu City) (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

112 cm TL (male/unsexed; (Ref. 84278)); 120 cm TL (female)
  • Last, P.R., J.J. Pogonoski and W.T. White 2010 A new wobbegong shark, Orectolobus leptolineatus sp. nov. (Orectolobiformes: Orectolobidae), from the Western Central Pacific. 1-16 pp. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of new sharks and rays from Borneo. CSIRO Marine and Atmospheric Research Paper no. 32. (Ref. 84278)   http://www.fishbase.org/references/FBRefSummary.php?id=84278&speccode=65548 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This medium-sized (to at least 120 cm TL) Orectolobus species is distinguished by the following set of characters: coloration complex and variable, strongly vermiculate over dorsal and lateral surfaces with alternating dark brownish bars and saddles; dorsal and upper surface of paired fins with prominent vermicular patterns; ventral surface of trunk mainly uniformly pale; nasal barbel with a branch; preorbital dermal lobes complex, with 2-3 simple lobes in PO1 group and 3-4 simple to terminally branched lobes in PO2; simple postspiracular dermal lobes, well- developed, thallate, distance across preorbital group 1.3-1.6 times interspace between preorbital group and postspiracular lobe (PO/PO-PS1), 6.5-8.0 times base length of anterior postspiracular lobe (PO/PS1); base of anterior postspiracular lobe 4.3-5.3 in its distance from postorbital group (PO-PS1/PS1), 2.5-2.9 in its distance from posterior postspiracular lobe (PS1-PS2/PS1); enlarged supraocular knob or warty tubercles on back absent; dorsal fins tall, upright; first dorsal-fin origin near insertion of pelvic fin; tip of pelvic fin below insertion of first dorsal fin; interdorsal space 0.5-0.8 times anal-fin base length; anal-fin inner margin 0.7-0.8 of anal-fin posterior margin; 23 tooth rows in upper jaw, rudimentary row of teeth at symphysis of upper jaw usually present; monospondylous centra 44-51; total vertebral centra about 148-163 (Ref. 84278).
  • Last, P.R., J.J. Pogonoski and W.T. White 2010 A new wobbegong shark, Orectolobus leptolineatus sp. nov. (Orectolobiformes: Orectolobidae), from the Western Central Pacific. 1-16 pp. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of new sharks and rays from Borneo. CSIRO Marine and Atmospheric Research Paper no. 32. (Ref. 84278)   http://www.fishbase.org/references/FBRefSummary.php?id=84278&speccode=65548 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus leptolineatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTTCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCTCACGCCGGATCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAATCCTTCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus leptolineatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!