Overview

Brief Summary

North American Ecology (US and Canada)

Ancyloxypha numitor is resident throughout the eastern United States and southeastern Canada (Scott 1986). Habitats are subtropical to lower Canadian zone moist grassy places and streamsides. Host plants are multiple species of grasses. Eggs are laid on broad-leaved grasses singly. Individuals overwinter as third and fourth instar larvae. There are several flights each year with the approximate flight time June 15-early July and Aug. 1-early Sept in the northern part of their range, and multiple flights between Feb. 1 - Dec. 31 in the most southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The small size (19 to 25 mm wingspan), weak flight, in combination with a dark fore- and orange hindwing make this quite a distinctive skipper.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern United States and southeastern Canada west to extreme eastern Saskatchewan (Layberry et al. 1998, Opler 1999). The only known Alberta record (3 July 1909) from Lethbridge (Bird et al. 1995) is well outside of the known range, and may represent a stray individual.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Ancyloxypha longleyi French, 1897
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): W. Longley
Year Collected: 1896
Locality: Oak Park, Ill., Illinois, United States
  • Type: French. 1897. Canadian Entomologist. 29: 80.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Restricted to wet meadows and streamsides.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adapatable to a variety of temporary and permanent open or brushy wetlands from fens to ditches to temporarily drought impacted ponds. In wooded areas only along grassy stream corridors. Typical of disturbed grassy areas on pondshores, along ditches etc. Less often in drier grassy places and suburbia but probably breeds in such settings to some extent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In Manitoba, Least Skipper larvae feed on bluegrass (Poa spp.) and Rice Cutgrass (Leersia oryzoides) (Layberry et al. 1998), and in North Dakota on Giant cutgrass (Zizaniopsis miliacea) and bluegrass (Poa spp.) (McCabe & Post 1977). Of these, only bluegrasses occur in Alberta (Moss 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Ancyloxypha numitor in Illinois

Ancyloxypha numitor Fabricius: Hesperiidae, Lepidoptera
(observations are from Bouseman, Sternburg, & Wiker, Fothergill & Vaughn; this is the Least Skipper)

Fabaceae: Strophostyles helvola sn (FV); Pontederiaceae: Pontederia cordata sn (BSW); Verbenaceae: Phyla lanceolata sn (FV)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Possibly double-brooded, with a late Jun to early Jul and an Aug to Sep flight.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Unknown in Alberta; The egg is yellow with a reddish middle band (Bird et al. 1995). Mature larvae are light green with white patches and lines, a brown head, and live in shelters constructed from grass blades (Layberry et al. 1998). Adults have a weak flight, and fly in amongst tall grasses (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ancyloxypha numitor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGTACTTCTCTTAGCTTGTTAATCCGTACAGAATTAAGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCACATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTGATCCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTCTGAATATTACCCCCTTCTTTAACACTTTTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCCCTCTCTTCTAATATTGCCCATCAAGGACCTTCTGTTGATTTAGCAATTTTCTCCTTACATTTAGCAGGAATTTCATCAATTCTAGGAGCAATTAATTTCATTACAACTATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATCACAGCATTACTTTTACTTTTATCTTTACCAGTTTTAGCTGGTGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCATTCTTTGATCCTGCAGGAGGTGGAGATCCTATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ancyloxypha numitor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status undetermined; may be a rare stray.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ancyloxypha numitor

The Least Skipper (Ancyloxypha numitor) is a North American butterfly in the family Hesperiidae. They have a weak, satyr-like flight.[1][2]

Contents

Description

upper side
ventral view

The Least Skipper's rounded wings and slender body are distinctive. Their checkered antennae have no hooks. Males lack stigmata. The upper sides of the fore wings are dark brownish-black sometimes having a patch of orange. The hind wing is orange with a broad dark brownish-black band surrounding the orange area completely. The underside of the wings is orange with the hind wing discal area being a little bit darker. The hind wing veins are whitish.[1] Its wingspan ranges from 17 to 26 mm.[3][4]

Similar species

There are four similar species in the Least Skipper's range. They are the European Skipper (Thymelicus lineola), the Tropical Least Skipper (Ancyloxypha arene), the Orange Skipperling (Copaeodes aurantiaeca), and the Southern Skipperling (Copaeodes minima).[2]

The European Skipper has more pointed wings than the Least Skipper, the antennae are short and not checkered, and the upper side of the wings is mostly orange or reddish-orange with thin black wing margins. Males also have very thin, black stigmata near the costal fore wing edge.[1]

The Tropical Least Skipper has more orange on the upper side of the wings than the Least Skipper, and the underside of the wings has very small black marginal spots.[5]

The Orange Skipperling is almost all bright orange on the upper side except for the basal areas being black. Males have black stigmata, and females usually have some black below the fore wing cell.[2]

The Southern Skipperling is smaller than the Least Skipper (it is also the smallest skipper in the United States) and the underside of the hind wing has a white ray which runs the width of the hind wing from the basal area to the margin.[2]

Habitat

The Least Skipper favors damp or wet habitats with tall grasses.[1]

Flight

Adults may be noticed on the wing from May to September in the north and February to December in the south. It may be seen all year in southern Florida.[1][6]

Life cycle

To find females, males will patrol through stands of grass.[1] Females lay their eggs singly on the host plant. The pale yellow eggs will soon form an orange-red ring round the middle.[7] The larvae make a nest by rolling up a single blade of grass or by using silk to tie together multiple leaves. The variable larva is grass green with four white pairs of distinct wax glands along the subventral area of the abdomen. The head is either brown or tan and is usually darker in the center. The collar has a white stripe and a black stripe.[8][9] The cream pupa has brownish colored markings. It overwinters as a larva in the third or fourth instar.[7] It has 2–4 broods per year.[1]

Host plants

Here is a list of host plants that the Least Skipper uses:

References

  1. ^ a b c d e f g h Rick Cech and Guy Tudor (2005). Butterflies of the East Coast. Princeton University Press, Princeton, NJ. ISBN 0-691-09055-6
  2. ^ a b c d Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 978-0-618-15312-1
  3. ^ Least Skipper, Butterflies of Canada
  4. ^ Ernest M. Shull (1987). The Butterflies of Indiana. Indiana Academy of Science. ISBN 0-253-31292-2
  5. ^ Jeffrey Glassberg (2007). A Swift Guide to the Butterflies of Mexico and Central America. Sunstreak Books, Morristown, NJ. OCLC 150485166
  6. ^ David C. Iftner, John A. Shuey, and John V. Calhoun (1992). Butterflies and Skippers of Ohio. College of Biological Sciences and The Ohio State University. ISBN 0-86727-107-8
  7. ^ a b c James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, CA. ISBN 0-8047-2013-4
  8. ^ David L. Wagner (2005). Caterpillars of Eastern North America. Princeton University Press, Princeton, NJ. ISBN 0-691-12144-3
  9. ^ Thomas J. Allen, Jim P. Brock and Jeffrey Glassberg (2005). Caterpillars in the Field and Garden. Oxford University Press, New York, NY. ISBN 0-19-514987-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!