Molecular Biology and Genetics

Molecular Biology

Barcode data: Conchylodes nolckenialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 93 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATACTTTTTATTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGATTATTAATCCGAGCTGAATTAGGAAATCCAGGATCATTAATTGGGGATGATCAAATTTATAACACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATACTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTTCCCCCATCTTTAACACTGTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCCAATATCGCTCACAGAGGAACATCTGTAGATTTAGCTATTTTCTCATTACATCTTGCCGGAATTTCATCAATTCTAGGGGCAATCAATTTTATCACAACAATCATTAATATACGAATTAATAGATTATCATTCGATCAAATACCTCTATTTGTTTGAGCTGTAGGAATTACTGCTTTATTACTACTTTTATCTTTACCGGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCTTTTTTCGACCCAGCAGGAGGGGGAGACCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conchylodes nolckenialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 119
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conchylodes nolckenialis

Conchylodes nolckenialis is a moth in the Crambidae family. It was described by Snellen in 1875.[1] It is found in Colombia.[2] It has also been recorded from Honduras.

References[edit]

  1. ^ "global Pyraloidea database". Globiz.pyraloidea.org. Retrieved 2014-07-15. 
  2. ^ Conchylodes at funet


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!