Molecular Biology and Genetics

Molecular Biology

Barcode data: Euchloe ausonia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGNTCTGGTATAATTGGTACCTCTCTTAGTTTATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTAATGTTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTACCCCCATCCTTAACTCTTTTAATTTCAAGAAGAATCGTTGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCTTCTGTAGATTTGGCTATTTTTTCATTACATTTAGCTGGTATTTCATCTATTCTTGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCTGTAGGTATTACAGCATTATTATTACTTTTATCATTACCAGTTTTAGCTGGTGCTATCACCATACTTTTAACAGATCGTAATCTTAATACTTCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euchloe ausonia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Euchloe ausonia

The Eastern Dappled White (Euchloe ausonia) is a southern Europe and Eurasian butterfly found mostly to the south and east of its almost indistinguishable relative the Western Dappled White.

The wingspan is 36–48 mm. In most of its range, there are two generations. Adults are on wing from the beginning of March to the beginning of July. In mountainous and very dry areas, there is only one generation.

The larvae feed on the flowers and young fruits of Sinapis arvensis, Isatis tinctoria, Isatis glauca, Aethionema saxatile, Iberis sempervirens, Biscutella mollis, Biscutella laevigata, Bunias erucago and Aurinia saxatilis.

Systematics and subspecies [edit]

The three species Euchloe ausonia, Euchloe crameri and Euchloe simplona are closely related. Many authors refer to these species as the Euchloe ausonia-complex, -superspecies or -speciesgroup. Sometimes Euchloe naina is also added to this group, but the placement of this species as a subspecies of Euchloe simplonia or valid species is disputed by others. Because of these taxonomic problems, the number of subspecies is not cenrtain. The following subspecies are listed:

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Euchloe ausonia dephalis

Pearl White, Euchloe ausonia subspecies dephalis is a small butterfly of the Family Pieridae, that is, the Yellows and Whites, which is found in India.

References

  • Evans, W.H. (1932) The Identification of Indian Butterflies. (2nd Ed), Bombay Natural History Society, Mumbai, India
  • Gaonkar, Harish (1996) Butterflies of the Western Ghats, India (including Sri Lanka) - A Biodiversity Assessment of a threatened mountain system. Journal of the Bombay Natural History Society.
  • Gay,Thomas; Kehimkar,Isaac & Punetha,J.C.(1992) Common Butterflies of India. WWF-India and Oxford University Press, Mumbai, India.
  • Kunte,Krushnamegh (2005) Butterflies of Peninsular India. Universities Press.
  • Wynter-Blyth, M.A. (1957) Butterflies of the Indian Region, Bombay Natural History Society, Mumbai, India.

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!