Overview

Comprehensive Description

General comments

This information is based an ongoing project dedicated to the inventory and dissemination of information on lepidopteran larvae, their host plants, and their parasitoids in a Costa Rican tropical wet forest and an Ecuadorian montane cloud forest.


N=31 rearings, 16 eclosed and 15 died.

Adults are sexually dimorphic.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Collected in Heredia Province, Costa Rica.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phoebis argante

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phoebis argante

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGGACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTCTACCCCCCTCATTAACTTTATTAATTTCTAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGAGGATCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGGGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATATATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTTGGTATTACTGCATTACTTTTATTATTATCTCTTCCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATCTTAATACATCATTTTTTGACCCTGCTGGGGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Phoebis argante

Phoebis argante, the Apricot Sulphur or Argante Giant Sulphur , is a butterfly in the Pieridae family.

Description[edit]

Phoebis argante has a wingspan of about 54–67 millimetres (2.1–2.6 in). The uppersides of male's wings are bright orange a with thin black or dark brown border on forewings. The hindwings are slightly paler and have two small whitish spots in the middle. The basic colour of the females vary from white to yellow, with dark borders.

Larvae feed on Pentaclethra macroloba, Cassia biflora, Cassia fruticosa, Inga vera, Inga ruiziana.

Distribution[edit]

This species can be found from Mexico up to Peru, in Antilles and in Cuba.

Subspecies[edit]

The following subspecies are recognised:

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!