Overview

Brief Summary

North American Ecology (US and Canada)

Mostly migratory in North America (Scott 1986). Habitats are SUBTROPICAL AREAS OR BRUSHY WOODS. Host plants can be shrubs or trees with most known hosts from Leguminosae. There are multiple flight(s) each year with the approximate flight time MAR15-DEC15 in Florida and year-round in South Texas (Scott 1986)
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Subspecies AGARITHE, Texas and Mexico, wandering to Arizona, Arkansas, Kansas. Subspecies MAXIMA reaches southern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Clearings, edges of subtropical scrub, thorn forest. Hosts are Pithecellobium guadelupense, P. unguiscati, genus Inga.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoebis agarithe

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTCCTACCCCCCTCATTAACTTTATTAATTTCTAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCAAATATTGCTCATAGAGGATCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATATATCTTTTGATCAAATACCATTATTTGTCTGAGCTGTTGGTATTACTGCATTACTTTTATTATTATCCCTTCCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoebis agarithe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, common, weedy Neotropical species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Phoebis agarithe

The Orange Giant Sulphur or Large Orange Sulphur (Phoebis agarithe) is a butterfly in the Pieridae family. It is found from Peru north to southern Texas and peninsular Florida. Rare strays can be found up to Colorado, South Dakota, Wisconsin, and New Jersey. The species has also been introduced in Hawaii.[2] The habitat consists of open, tropical lowlands including gardens, pastures, road edges, trails and parks.[3]

The wingspan is 57–86 mm (2.2–3.4 in). The upper surface of the males is bright orange without markings. There are two female forms, a pink-white and yellow-orange form. The underside of the forewings of both sexes has a straight submarginal line. There are two seasonal forms: the winter form has heavier underside markings. Adults are on wing from August to September in southern Texas and all year round in the tropics. They feed on flower nectar, favoring lantana, shepherd's needle, bougainvillea, rose periwinkle, Turk's cap and hibiscus.[3]

The larvae feed on fresh leaves of Pithecellobium and Inga species.[3]

Subspecies[edit]

The following subspecies are recognised:[1]

References[edit]

  1. ^ a b Phoebis, Site of Markku Savela
  2. ^ "Butterflies of Hawaii, United States". Butterflies and Moths of North America. Retrieved 16 December 2013. 
  3. ^ a b c Butterflies and Moths of North America
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!