Overview

Brief Summary

North American Ecology (US and Canada)

Resident throughout southern US with migratory expansion in much of the US (Scott 1986). Habitats areTROPICAL TO LOWER AUSTRAL ZONE OPEN AREAS. Host plants are usually herbaceous with most known hosts largely restricted to one genus, Cassia, in Leguminosae. Eggs are laid on the host plant singly. Individuals overwinter as adults. There are multiple flights each year with the approximate flight time JUL15-SEP1 in the north and all year in the southern part of the range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout the southern and southwestern United States, north to Colorado. Migrates northward east of the Rockies. Also extends south to Brazil. Limit of year round residency in United States is unclear.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Open areas: old fields, open pine woods and edges, scrub, canyons. Hosts in family Fabaceae, esp. Cassia, Trifolium. Vagrants in any open habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Eurema nicippe in Illinois

Eurema nicippe Cramer: Pieridae, Lepidoptera
(observations are from Robertson; this butterfly is the Sleepy Orange)

Asteraceae: Aster pilosus sn (Rb), Cirsium vulgare sn (Rb), Erigeron philadelphicus sn (Rb); Brassicaceae: Cardamine bulbosa sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Eurema nicippe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Abaeis nicippe

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACAATATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTTTGATTATTACCTCCTTCATTAACCTTATTAATTTCTAGCAGAATTGTTGAAAATGGAGCTGGAACCGGTTGAACAGTTTACCCTCCTTTATCTTCTAATATCGCTCATAGAGGTGCATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATGCGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTATTACTTTCTTTACCAGTTTTAGCTGGAGCCATTACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Abaeis nicippe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: One of most abundant pierids in southern U.S. A wide- ranging weedy species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurema nicippe

The Sleepy Orange (Eurema nicippe) is a North American butterfly in the family Pieridae.

Description[edit]

Sleepy Oranges puddling on damp ground.

For a key to the terms used, see Lepidopteran glossary

The Sleepy Orange is a bright orange butterfly with the upper side of the wings having wide black borders. The forewing coastal margin has a small, narrow black spot. Some people[who?] think that the Sleepy Orange got its name from the black spot that looks like a closed eye; others say that the Sleepy Orange is a misnomer because, when disturbed, the butterfly has a very rapid flight. The underside of the wings varies seasonally: summer forms are bright yellow with brick red markings, while winter forms are browner and more heavily marked. It has a wingspan of 138–214 inches.

Habitat[edit]

The Sleepy Orange may be found in or around old fields, roadsides, woods edges, swamps, wet meadows, open woodlands, margins of ponds, waterways, and valleys.

Life cycle[edit]

The eggs are pale greenish-yellow and turn red just before hatching. They are laid on the underside of the host plant leaves, or sometimes on flowers. The larva is fuzzy and grayish-green, with a whitish-yellow side stripe. The chrysalis varies from green to brownish black. Adult Sleepy Oranges migrate south to spend the winter. They have 2–4 broods per year.

Host Plants[edit]

Here are a list of host plants for the Sleepy Orange:

Similar Species[edit]

References[edit]

  • Jim P. Brock, Kenn Kaufman (2003). Butterflies of North America. Boston: Houghton Mifflin. ISBN 0-618-15312-8.
  • James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, California. ISBN 0-8047-2013-4
  • Ernest M. Shull (1987). The Butterflies of Indiana. Indiana Academy of Science. ISBN 0-253-31292-2
  • Rick Cech and Guy Tudor (2005). Butterflies of the East Coast. Princeton University Press, Princeton, New Jersey. ISBN 0-691-09055-6
  • David L. Wagner (2005). Caterpillars of Eastern North America. Princeton University Press, Princeton, New Jersey. ISBN 0-691-12143-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!