Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Brief Summary

The cabbage white butterfly (Pieris rapae), also known as the cabbage butterfly and the imported cabbageworm, is so named because the larval stage feeds on members of the cabbage family (Cruciferae). This species is found around the world in temperate climates. It was introduced to North America in the 1860's and has since spread throughout the continent. The cabbage white butterfly is known to pollinate several species in the United States.

The cabbage white butterfly has a black body with white wings. The upper wings have a black band at the tip and a black spot in the center of each upper wing. Males have one spot on each wing and females have two. The underneath of the wings are yellowish-green. These butterflies have a wingspan of 30 to 50 mm. Caterpillars are green or bluish-green with a light yellow stripe.

  • Species Pieris rapae - Cabbage White (Bugguide, Iowa State University Entomology)
  • Species Detail: Cabbage White - Pieris rapae (Linnaeus, 1758) (Butterflies and Moths of North America, Big Sky Institute, Montana State University)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 2 people

Average rating: 5.0 of 5

North American Ecology (US and Canada)

Resident throughout North America with migrants north (Scott 1986). Habitats are TOWNS, SOME VALLEY BOTTOMS. Host plants are usually herbaceous including species from many families, including Cruciferae. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There is a variable number of flights based on latitude each year with the approximate flight time JUN1-JUL1 in the northern part of the range and APR15-OCT15 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This widespread and familiar white butterfly is one of the most common butterflies in Europe (5). As the name suggests, adults have whitish upper wings. The forewings have black tips and the undersides of the wings are bright yellow, featuring blackish scales. Males and females are easy to distinguish, as females have two prominent black spots and a blackish streak on the forewing (2). The caterpillar has a green body with black spots and fine hairs. A thin yellowish line extends along the centre of the back and the spiracles are bordered with yellow (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The small white is typically a double-brooded species, with two generations each year. The eggs, which hatch after around one week, are laid in April and then again in June. The female deposits them singly on the underside of leaves of the foodplants (3). Cultivated brassicas such as cabbages and nasturtium are preferred, although wild brassicas including wild cabbage, hedge mustard and wild mignonette are also used (4). The caterpillars tend to feed on the hearts of cabbages, not on the outer leaves. They are solitary and are fully grown after one month. They then undergo pupation; the pupa is attached either to the foodplant or to fences and other structures. Adults emerge from the pupae of the first generation after roughly three weeks, but the pupae belonging to the second generation overwinter, with adults emerging the following spring. In years when the weather is particularly clement, a third brood may occasionally be produced (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

General Description

This is the only species of white which has both unmarked hindwing undersides and at least one black spot on the forewing upperside and the leading edge of the hindwing upperside. Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Size: 46-55 mm. A small version of Pieris brassicae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The Cabbage White was introduced from Europe to Quebec in the 1860's (Layberrry et al. 1998), and has since spread over all of North America with the exception of the Arctic and some of the extreme southern parts of the U.S. (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Introduced into North America south of the Arctic. Rare in southern Florida and in southern Gulf states. Also occurs in Africa, Eurasia, and Japan.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

61 records. Latest in 2006 (oases)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO = 184 km2. EOO = 243,000 km2. 9 locations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Distribution

Widespread (Palaearctic; introduced worldwide)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The small white has a wide distribution in Britain, but it becomes scarce in the Scottish Highlands. The distribution of this species seems to have stayed fairly stable, however numbers are thought to have dropped following the introduction of insecticides in the 1950s (4). Elsewhere, this butterfly is found throughout Europe and north-west Africa, reaching Asia as far east as Japan (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Ubiquitous throughout the province, particularly near agricultural habitats.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Mostly disturbed open areas but also invading natural situations. In wooded areas mostly in spring before the canopy closes but seems to be becoming more forest adapted as garlic mustard increases explosiovely in the East.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Always associated with cultivation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in a range of habitats, where the food plants (such as cabbage, nasturtium and related plants) occur (3). Typical habitats include fields, gardens, and waste land, although they are often found in smaller numbers in woodland edges, hedgerows and other sheltered places (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae sometimes reach pest status on cultivated mustards such as cabbage, broccoli, cauliflower and canola. A large number of Brassicaceae have been recorded as hosts, particularly introduced, weedy species (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Host-plants: Cultivated brassicas (Cruciferae), especially cabbages; nasturtiums (Tropaeoleum majus) in gardens; wild crucifers and Reseda lutea (Resedaceae).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Pieris rapae in Illinois

Pieris rapae Linnaeus: Pieridae, Lepidoptera
(observations are from Robertson, Graenicher, Wiggam & Ferguson, Betz et al., Hilty, Lewis, Catling, Larson & Barrett, Conger, and Willson & Bertin; this butterfly is the Cabbage White)

Acanthaceae: Justicia americana sn (Rb, Cng); Apiaceae: Sium suave sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] [plup sn] (Rb, Btz), Asclepias verticillata [plab sn] [plup sn fq] (Rb, WB); Asteraceae: Anthemis cotula sn (Gr), Arctium lappa sn (Gr), Arctium minus sn (Rb), Aster anomalus sn (Rb), Aster drummondii sn (Gr), Aster ericoides sn (Rb), Aster furcatus sn (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb, Gr), Aster lateriflorus sn (Gr), Aster novae-angliae sn (Gr), Aster pilosus sn (Rb, H), Aster prenanthoides sn (Gr), Aster puniceus sn (Gr), Bidens aristosa sn (Rb), Bidens bipinnata sn (Rb), Boltonia asterioides sn (Rb), Cirsium altissimum sn (Gr), Cirsium arvense sn (Gr), Coreopsis palmata sn (Rb), Echinacea purpurea sn (Rb), Eupatoriadelphus purpureus sn (Rb, Gr), Eupatorium perfoliatum sn (Gr), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn (Gr), Helenium autumnale sn (Gr), Helianthus annuus sn (Rb), Helianthus giganteus sn (Gr), Helianthus strumosus sn (Gr), Leucanthemum vulgare sn (Lw), Liatris aspera sn (H), Liatris pycnostachya sn (Rb), Liatris spicata sn (Gr), Oligoneuron rigidum sn (H), Rudbeckia hirta sn (Rb), Silphium integrifolium sn (H), Silphium perfoliatum sn (Rb), Vernonia fasciculata sn (Rb); Boraginaceae: Buglossoides arvense sn (H), Lithospermum canescens sn (Rb); Brassicaceae: Barbarea vulgaris sn (H, Lw), Cardamine bulbosa sn (Rb); Campanulaceae: Lobelia spicata sn (Rb), Triodanis perfoliata sn (Rb, Lw); Caryophyllaceae: Stellaria media sn (Lw); Fabaceae: Crotalaria sagittalis sn np (Rb), Lotus corniculatus sn np (Lw), Trifolium pratense sn (Rb, Lw), Trifolium repens sn (Rb, Lw); Fumariaceae: Dicentra cucullata sn np (Rb); Lamiaceae: Agastache nepetoides sn (Rb), Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Glechoma hederacea sn np (Rb), Mentha arvensis sn (Rb), Nepeta cataria sn (Rb), Prunella vulgaris sn (Rb, Lw), Pycnanthemum pilosum sn (H), Pycnanthemum tenuifolium sn (Rb), Scutellaria incana sn np (H), Teucrium canadense sn (Cng); Liliaceae: Allium cernuum sn (Gr), Erythronium albidum sn (Rb), Nothoscordum bivalve sn (Rb), Smilacina stellata sn (Gr), Tofieldia glutinosa sn (Gr); Lythraceae: Lythrum alatum sn (Rb); Malvaceae: Abutilon theophrastii sn (Rb), Hibiscus trionum sn (Rb), Malva neglecta sn (Rb), Sida spinosa sn fq (Rb); Melastomataceae: Rhexia virginica exp np (LBt); Orchidaceae: Spiranthes lacera sn np (Ct); Oxalidaceae: Oxalis corniculata sn (Rb), Oxalis stricta sn (Rb, Lw); Papaveraceae: Sanguinaria canadensis exp (Gr); Parnassiaceae: Parnassia glauca sn (Gr); Polemoniaceae: Phlox divaricata laphamii sn (WF); Polygonaceae: Fallopia scandens sn (Rb), Persicaria pensylvanica sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Fragaria virginiana sn (Rb), Potentilla argentea sn (Lw), Potentilla recta sn (Lw); Rubiaceae: Cephalanthus occidentalis sn (Rb), Houstonia lanceolata sn (Rb); Scrophulariaceae: Agalinis tenuifolia sn np (Rb), Dasistoma macrophylla sn np (Rb), Linaria vulgaris sn np (Rb), Veronicastrum virginicum sn (Rb); Verbenaceae: Verbena stricta sn fq (Rb, H), Verbena urticifolia sn (Rb); Violaceae: Viola cucullata sn (Rb), Viola pedata sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Pieris rapae

Animal / parasitoid / endoparasitoid
larva of Epicampocera succincta is endoparasitoid of larva of Pieris rapae

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Pieris rapae

Foodplant / internal feeder
caterpillar of Pieris rapae feeds within live heart of Brassica oleracea var. capitata

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Occurs in multiple generations from April into September.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Like other Pieris species, the eggs are yellow and conical, with longitudinal ridges. Mature larvae are green with a pale dorsal stripe, and pupae range in colour from brown to green (Guppy & Shepard 2001). The first Cabbage Whites usually emerge in late April from hibernating pupae. There are usually three generations per year in Alberta (Bird et al. 1995). Up to four occur in southern BC, with development time of each generation varying from 4 to 8 weeks according to temperature (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Flight Period

March-October

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Two or more generations per year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These butterflies are one of the first to be seen in the spring and one of the last to be seen in the fall. These butterflies can fly from February to mid-November; they have a shorter season in their northern range and a longer season in the south. Females produce between 300 and 400 eggs; each is laid singly on the underside of host plants. Caterpillars hatch and feed on plants from the cabbage family (Brassicaceae). They then molt five times before turning into a chrysalis. Chrysalids hibernate and hatch into adult butterflies. Adults live about three weeks. Cabbage white butterflies have between two and eight generations per year.

  • Species Pieris rapae - Cabbage White (Bugguide, Iowa State University Entomology)
  • Species Detail: Cabbage White - Pieris rapae (Linnaeus, 1758) (Butterflies and Moths of North America, Big Sky Institute, Montana State University)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Reflectance causes white color: cabbage butterfly
 

The wings of the cabbage butterfly are white due to longitudinal ridges and cross-ribs studded with ovoid beads.

     
  "The small white, Pieris rapae, offers an interesting example of the biology of wing coloration. Both sexes of this butterfly species are rather featureless for human eyes, except for slight differences in the black spots, small wing areas where the wing scales contain melanin. The white color is caused by strongly scattering structures in the wing scales (Stavenga et al., 2004). The reflectance is only high above 450 nm, but it is minor below 400 nm, because the scales of male P. rapae crucivora contain a substantial amount of UV-absorbing pteridins." (Stavenga and Arikawa 2006:314)

"Fig. 7. Coloration of pierid butterflies...(b) The wing scales are marked by longitudinal ridges and cross-ribs. (c) The cross-ribs are studded with ovoid beads...(d) The wing scales strongly scatter, but due to pteridin pigment, which strongly absorbs in the UV, the reflectance is low in the UV." (Stavenga and Arikawa 2006:315)
  Learn more about this functional adaptation.
  • Stavenga, D.G.; Arikawa, K. 2006. Evolution of color and vision of butterflies. Review. Arthropod Structure & Development. 35: 307-318.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pieris rapae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 127
Specimens with Barcodes: 342
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pieris rapae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 115 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACTAACCATAAAGATATTGGAACTTTATATTTTATCTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGAACTGAATTAGGAAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAAAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTACTTTTACTATTATCATTACCAGTTCTAGCAGGAGCCATTACAATACTTTTAACAGACCGAAATTTAAATACCTCATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTTTACATTTTAATTTTACCGGGATTTGGAATAATTTCTCATATTATTTCACAAGAAAGTGGGAAAAAGGAAACTTTTGGTTCTTTAGGAATAATTTATGCCATAATAGCAATTGGTCTTTTAGGGTTTATTGTATGAGCTCATCATATATTCACAGTTGGTATAGATATTGATACTCGAGCATATTTTACATCAGCTACAATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTAGCAACTCTTTATGGAACTCAAATTAATTACAGACCTTCAATATTATGAAGATTAGGATTTGTTTTCTTATTTACTGTTGGAGGTTTAACCGGAGTAATTTTAGCAAATTCTTCTATTGATATTATCCTTCATGACACATATTATGTTGTAGCACATTTTCACTATGTTTTATCTATAGGAGCTGTATTTGCTATTTTAGGAGGATTTATCCATTGATACCCACTTTTTACTGGATTAAGATTAAATAATTATTATTTAAAAATTCAATTTATTGTAATATTTATTGGGGTTAACTTAACTTTTTTCCCTCAACATTTCTTAGGATTAGCTGGAATACCTCGACGATACTCAGATTACCCAGATAATTACTTATCTTGAAATATTGTTTCATCATTAGGATCTTATATTTCTTTAATTGCAACAATTATAATAATAATAATCATTTGAGAGTCAATAATCAATCCTCGAATAATCATTTTTTCATTAAATATACCTTCTTCAATTGAATGATACCAAAATCTTCCGCCAGCAGAACATTCTTATAATGAATTACCAATTATAAGTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident and migrant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN

Least Concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abundance

Abundant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Not threatened (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None, widespread common economic pest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

Recent research has shown that it is actually four times more efficient at pollinating wild radish (Raphanus raphanistrum) than honey bees (Apis mellifera) because honey bees are foraging for both pollen and nectar and most likely groom away pollen from their bodies. In addition to wild radish, cabbage white butterflies are pollinators of red clover (Trifolium pratense), common dandelion (Taraxacum officinale), black-eyed susan (Rudbeckia hirta), buttonbush (Cephalanthus spp.), bird's-foot violet (Viola pedata), and wild strawberry (Rosaceae).

In addition to being pollinators, this species can be considered a pest because the larvae feed on the foliage of crop plants like broccoli, Brussels sprouts, cabbage, cauliflower, collard, horseradish, kale, and kohlrabi. Larvae of this species have the ability to reduce mature plants to stems and large veins by eating foliage. Larvae have also been known to burrow into the heads of broccoli and cabbage; they are difficult to dislodge and produce large amounts of fecal material.

  • The Effect of Wild Radish Floral Morphology on Pollination Efficiency by Four Taxa of Pollinators, J. K. Conner, R. Davis, and S. Rush, Oecologia, Vol. 104, No. 2 (1995), pp. 234-245
  • Cabbage White (Pieris rapae) (Fairfax County Public Schools); Featured Creatures: Imported Cabbageworm, John L. Capinera, University of Florida, Institute of Food and Agricultural Science
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Pest of brassica crop

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pieris rapae

The Small White (Pieris rapae) is a small- to medium-sized butterfly species of the Yellows-and-Whites family Pieridae. It is also known as the Small Cabbage White and in New Zealand, simply as White Butterfly.[1] The names "Cabbage Butterfly" and "Cabbage White" can also refer to the Large White. The butterfly can be distinguished by the white color with small black dots on its wings. They are distinguished from the smaller size and lack of the black band at the tip of their forewings.

It is widespread and populations are found across Europe, North Africa, Asia, and Great Britain. It has also been accidentally introduced to North America, Australia and New Zealand. The caterpillar of this species is seen as a pest for commercial agriculture. Often referred to as the "imported cabbageworm" they are a serious pest to cabbage and other mustard family crops.

Description[edit]

Feeding on nectar

In appearance it looks like a smaller version of the Large White (Pieris brassicae). The upperside is creamy white with black tips on the forewings. Females also have two black spots in the center of the forewings. Its underwings are yellowish with black speckles. It is sometimes mistaken for a moth due to its plain appearance. The wingspan of adults is roughly 32–47 mm (1.25–2 in).[2]

Distribution and habitat[edit]

The species has a natural range across Europe, Asia, and North Africa.[3] It was accidentally introduced to Quebec, Canada around 1860 and spread rapidly throughout North America.[4] The species has spread to all of North American life zones from Lower Austral/Lower Sonoran to Canada.[5] Estimates show that a single female of this species might be the progenitor in a few generations of millions.[6][7] It is absent or scarce in desert and semidesert regions (except for irrigated areas). It is not found north of Canadian life zone, nor on Channel Islands off the coast of southern California. By 1898, the Small White had spread to Hawaii; by 1929, it had reached New Zealand [8] and the area around Melbourne, Australia and found its way to Perth as early as 1943.

In Britain, it has two flight periods, April–May and July–August, but is continuously-brooded in North America, being one of the first butterflies to emerge from the chrysalis in the spring and flying until hard freeze in the fall.

The species can be found in any open area with diverse plant association. It can be seen usually in towns, but also in natural habitats, mostly in valley bottoms. Although an affinity towards open areas is shown, the Small White is found to have entered even small forest clearings in recent years.[9]

The nominate subspecies P. r. rapae is found in Europe, while Asian populations are placed in the subspecies P. r. crucivora. Other subspecies include atomaria, eumorpha, leucosoma, mauretanica, napi, novangliae, and orientalis.

Life cycle[edit]

The Small White will readily lay eggs on both cultivated and wild members of the cabbage family, such as Charlock (Sinapis arvensis) and Hedge mustard (Sisybrium officinale). P. rapae is known to lay eggs singly on the host plant. The egg is characterized by a yellowish color and 12 longitudinal ridges.[10] The egg production peaks about a week after adulthood in lab and the female can live up to 3 weeks. Females tend to lay fewer eggs on plants in clumps than on isolated plants.[5] It has been suggested that isothiocyanate compounds in the family Brassicaceae may have been evolved to reduce herbivory by caterpillars of the Small White.[11] However, this suggestion is not generally accepted because the small white has later been shown to be immune to the isothiocyanate forming reaction due to a specific biochemical adaptation. In contrast, the small white and relatives seem to have evolved as a consequence of this biochemical adaptation to the isothiocyanate-forming glucosinolates.

Traditionally known in the United States as the Imported Cabbage Worm, now more commonly the Cabbage White, the caterpillars are bluish-green, with tiny black pints, a black ring around the spiracles, and a lateral row of yellow dashes, and a yellow middorsal line.[4] Caterpillars rest on the undersides of the leaves, making them less visible to predators. Although the larval instars have not been fully studied, different instars are easily differentiated simply by comparing sizes, especially the head alone. During the first and second instar the head is entirely black; third instar has the clypeus yellow but the rest of the head black. In the fourth and fifth instar, there is a dark greenish-yellow dot behind each eye but with rest of the head black. However, the color of the caterpillar head does not necessarily indicate specific instar, as the time of color change is not fixed.[10] In the larval stage, the Small White can be a pest on cultivated cabbages, kale, radish, broccoli, and horseradish. The larva is considered a serious pest for commercial growth of cabbage and other Brassicaceae.[12]

The pupa of P. rapae is very close to that of P. napi. It is brown to mottled-gray or yellowish, matching the background color. It has a large head cone, with a vertical abdomen and flared subdorsal ridge.[5] The two (pupa of P. rapae and P. napi) can be easily distinguished by comparing the proboscis sheath. In P. rapae, the proboscis sheath extends far beyond the antennal sheath while in P. napi, only a very short distance.[10]

Like its close relative the Large White, the Small White is a strong flyer and the British population is increased by continental immigrants in most years. Adults are diurnal and fly throughout the day, except for early morning and evening. Although there is occasional activity during the later part of the night, it ceases as dawn breaks.[13] Adult P. rapae can move many kilometers in individual flights. Adults have been observed to fly as much as 12 km in one flight.[9] On average, a female flies about 0.7 km per day and moves 0.45 km from where she starts.[5] Males patrol all day around host plants to mate with females.

Behavior and ecology[edit]

Courtship and reproduction[edit]

The male, when it spots a female, zigzags up, down, below, and in front of her, flying until she lands. The male flutters, catches her closed forewings with his legs, and spreads his wings. This causes her to lean over. He usually flies a short distance with her dangling beneath him. An unreceptive female may fly vertically or spread her wings and raise the abdomen to reject the male.[14] Most host plants of P. rapae contain mustard oils and females use these oils to locate the plants. Females then lay the eggs singly on host leaves.[5] Adults appear as early as March and they continue to brood well into October. Spring adults have smaller black spots on its wings and are generally smaller than summer adults.[14]

Larvae feeding[edit]

P. rapae larva is voracious. Once it hatches from the egg, it eats its own eggshell and then moves to eat the leaves of the host plant. It bores into the interior of the cabbage, feeding on the new sprouts. The mustard oil from the hostplant makes the larvae distasteful to the bird. The larva adjust their feeding rate to maintain a constant rate of nitrogen uptake. They will feed faster in low nitrogen environment and utilize the nitrogen more efficiently (at the cost of efficiency in other nutrients) than larvae hatched on nitrogen high hostplant. However, no significant difference in growth rate was observed between larvae in the two environments.[5] Considered a serious pest, the caterpillar is known to be responsible for annual injury of hundreds of thousands of dollars.[7]

The larvae is shown to disperse their damage on the plant.[15] Larvae is shown to feed mostly during the day. It moves around the plant mostly spending its time feeding. A feeding bout is immediately followed by a change in position, either to a new leaf or to another part of the same leaf.[15] This dispersal of damage is seen as an adaptive behavior to hide the visual cues from predators that rely on vision. Even though P. rapae larvae are cryptic, they remain in the sun for the majority of the day, rather than hiding in the underside of the leaf. The condition of the host plant influences the larvae growth significantly.

Larval duration, pupal weights, adult weights, and larval growth rates were significantly altered by both plant nutrient availability and plant species. Larvae preferred Brassicaceae plants over other host plants. Larvae that have previously fed on crucifers will refuse nasturtium leaves to the point of starving to death.[16] Within the Brassicaceae family, larvae show no significant difference in feeding behavior; larvae placed on kale show no difference from larvae placed on Brussels sprouts.[17]

Survival rates do not differ depending on nutrition availability of host plant. Elevated plant nutrient levels decrease larval duration and increase larval growth rate.[16] The elevated nutrition level also decreased the fourth instar’s consumption rate and increased its food utilization efficiencies. Larvae on cultivated host plant was observed to have higher growth efficiency than those fed in foliage of wild species. In short, larvae fed on high nutrition foliage show shorter duration of development, less consumption rate, higher growth rate and food processing efficiency.[16] Larvae destroy more plants than they actually consume.

Adult feeding[edit]

Adult P. rapae use both vision and olfactory cues to identify flowers in their foraging flight.[18] The cabbage butterfly prefers purple, blue and yellow flowers over other floral colors; visiting these flowers multiply during its life.[18] Some flowers, like Brassica rapa, have a UV guide for aiding nectar search for the butterfly where the petals reflect near UV light whereas the center of the flower absorbs UV light, creating a visible dark center in the flower when seen in UV condition.[18] This UV guide plays a significant role in P. rapae foraging.

The adult flies around feeding from nectars of the plant. The adult looks for certain colors among green vegetation (purple, blue, and yellow preferred to white, red and green) and extend the proboscis before landing. They probe for nectar after landing. The butterfly identifies the flower through vision and odor. Chemical compounds such as Phenylacetaldehyde or 2-Phenylethanol was shown to provoke reflex proboscis extension.[19] The search for nectar is also limited by the memory constraint. An adult butterfly shows a flower constancy in foraging, visiting flower species that it has already experienced. The ability find nectar from the flower increased over time, showing a certain learning curve. Furthermore, the ability to find nectar from the first flower species decreased if the adult butterfly started to feed nectar from other plant species.[20]

Host selection[edit]

All known host plants contain natural chemicals called glucosinolates, that are cues for egg laying. Host plants are: herb Cruciferae - Arabis glabra, Armoracia lapthifolia, Armoracia aquatica, Barbarea vulgaris, Barbarea orthoceras, Barbarea verna, Brassica oleracea, Brassica rapa, Brassica caulorapa, Brassica napus, Brassica juncea, Brassica hirta, Brassica nigra, Brassica tula, Cardaria draba, Capsella bursa-pastoris (females oviposit but larvae refuse it), Dentaria diphylla, Descurainia Sophia, Eruca sativa, Erysimum perenne, Lobularia maritime, Lunaria annua (retards larval growth), Matthiola incana, Nasturtium officinale, Raphanus sativus, Raphanus raphanistrum, Rorippa curvisiliqua, Rorippa islandica, Sisymbrium irio, Sisymbrium altissimum, Sisymbrium officinale (and var. leicocarpum), Streptanthus tortuosus, Thlaspi arvense (larvae grow slowly or refuse it); Capparidaceae: Cleome serrulata, Capparis sandwichiana; Tropaeolum: Tropaeolum majus; Resedaceae: Reseda odorata.[5]

There is a three phase to host selection by the P. rapae adult female butterfly: searching, landing, and contact evaluation.[21] A gravid female adult will first locate suitable habitats, and then identify patches of vegetation that contain potential host plants. The cabbage butterflies seem to limit their search to open areas and avoid cool, shaded woodlands even when host plants are available in these areas.[21] Furthermore, gravid females will not oviposit during overcast or rainy weather. In laboratory conditions, high light intensity is required to promote oviposition. The females fly in a linear path independent of wind direction or position of the sun.[21]

Host plant searching behavior[edit]

Pre-mating females do not display host plant searching behavior. The behavior starts soon after mating.[22] Flight behavior of an ovipositing female of P. rapae follows the Markov process.[23] Females foraging for nectar will readily abandon a linear path; they will show tight turns concentrating on flower patches. Females searching for host plant, however, will follow a linear route. As a result of directionality, the number of eggs laid per plant declines with increases in host plant density.[23] The average move length declined as host plant density increases, but the decline is not enough to concentrate eggs on a dense host plant collard.[22] Although females avoid laying eggs on plants or leaves with other eggs or larvae in a lab condition; this discrimination is not shown in field conditions.

Adult females may search for a suitable Brassicaceae over a range of 500 m to several kilometers.[22]

Small differences in flight patterns have been observed in Canadian and Australian P. rapae, indicating that there may be slight variation between different geographic populations.

Plant Preference[edit]

Landing appears to be mediated primarily by visual cues, of which color is the most important. P. rapae in a lab environment showed no significant preference for the shape or size of the oviposiiton substrate.[21] Gravid females responded most positively to green and blue/green colors for oviposition. The preference was shown for surfaces with maximal reflectance of 550 nm.[21] In natural conditions, oviposition was preferred on larger plants, but this was not reflected in laboratory conditions. Younger plants often had yellow/green color while older plants display a darker and stronger green. Female butterflies preferred the older plants due to the attraction to the darker green color. However, larvae perform better on younger plants.

Behavior on plant[edit]

Once a gravid female lands on a plant, tactile and contact chemical stimuli are major factors affecting acceptance or rejection of the site for egg deposition. Once a female lands on a host plant, it will go through a “drumming reaction” or a rapid movement of the forelegs across the surface of a leaf. This behavior is believed to provide physical and chemical information about the suitability of a plant.[24] P. rapae is shown to prefer smooth hard surfaces similar to a surface of an index card over rougher softer textures like blotting paper or felt. P. rapae use their chemoreceptors on their tarsi to search for chemical cues from the host plant.[25] An adult female will be sensitive to number of glucosinolates, gluconasturtiin being the most effective glucosinolate stimulants for these sensilla.

Egg-laying behavior[edit]

A gravid female adult will lay disproportionate number of eggs on peripheral or isolated plants. Singe larva is less likely to exhaust the whole plant, therefore laying eggs singly prevents the likelihood of larval starvation from resource exhaustion.[25] This behavior may have evolved to exploit the original vegetation in the eastern Mediterranean where brassica plants originated.[17]

Age of butterflies appears to have no effect on their ability to select the source of highest concentration of oviposition stimulant.

Additionally, it has been shown that the weather has a large impact on the eggs of P. rapae. [26] The main issues with the weather are that strong winds can blow eggs from the leaves and strong rains can drown the caterpillars.[26]

Larval growth[edit]

Larvae feeding and growth is highly dependent on their body temperature. While the larvae survives from as low as 10 °C, the growth of larvae changes with changing temperature. From 10 °C to 35 °C, growth increases, but declines rapidly at temperatures higher than 35 °C. Past 40 °C, larvae start showing substantial mortality. The diurnal variation of temperature can be extensive with daily range of more than 20 °C on some sunny days and clear nights.[27] Larvae are able to respond well to a wide range of temperature condition, which allows them to inhabit various locations in the world. In natural conditions, larvae shows fastest growth at temperatures close to 35 °C. however, in constant temperature conditions in laboratory, larvae shows mortality at 35 °C.[27] In this lab condition, larvae grows between 10 °C to 30.5 °C while showing maximal developmental rate at 30.5 °C.[27] The difference between lab and natural condition is due to routine temperature changes on the scale of minutes to hours under field conditions.

Predation[edit]

Studies in Britain showed that birds are a major predator in British town and city environments (such as in gardens) while arthropods had larger influence in rural areas. Bird predators include the house sparrow Passer domesticus, goldfinch Carduelis carduelis and skylark Alandia orvensis.[28] Caterpillars are cryptic, coloured as green as the hostplant leaves and they rest on the undersides of the leaves, thus making them less visible to predators. Unlike the Large White, they are not distasteful to predators like birds. Like many other "White" butterflies, they hibernate as a pupa. Bird predation is usually evident only in late-instar larvae or on overwintering pupae.[28]

Parasitism[edit]

P.rapae caterpillars are commonly parasitized by a variety of insects. The four main parasatoids are Apanteles rubecula, Apanteles glomeratus, Phryxe vulgaris, and Epicampocera succinata.[26] A. rubecula lays its eggs in the 1st and 2nd instar caterpillars. The larvae then grow within the caterpillar and continue to feed on the caterpillar until they are almost fully grown, and at that point the caterpillar is killed.[26] It is important to note that only one larvae develops per host and the rate of A. rubecula is largely independent of P. rapae population size.[26] A. glomeratus is similar to A. rubecula in that both parasitize the host in either the 1st or 2nd instar. The main difference is that A. glomeratus always kill the host in the 5th instar and multiple larvae can be raised within one host.[26]

P. rapae pupae are frequently parasitized by Pteromalus puparum.[28]

References[edit]

  1. ^ RR Scott & RM Emberson (compilers) (1999). Handbook of New Zealand Insect Names. Entomological Society of New Zealand. ISBN 0-9597663-5-9. 
  2. ^ http://www.cbif.gc.ca/spp_pages/butterflies/species/CabbageWhite_e.php
  3. ^ Scudder, SH (1887). "The introduction and spread of Pieris rapae in North America, 1860-1886". Memoirs of the Boston Society of Natural History 4 (3): 53–69. doi:10.5962/bhl.title.38374. 
  4. ^ a b Howe, William H.; editor, coordinating; al.], illustrator & twenty contributors--contributors, David L. Bauer ... [et (1975). The Butterflies of North America. Garden City, N.Y.: Doubleday. ISBN 0-385-04926-9. 
  5. ^ a b c d e f g Scott, James A. (1986). The butterflies of North America : a natural history and field guide. Stanford, Calif.: Stanford University Press. ISBN 0-8047-1205-0. 
  6. ^ Gilbert, N. (June 1984). "Control of Fecundity in Pieris rapae: I. The Problem". Journal of Animal Ecology. 2 53: 581–588. doi:10.2307/4536. 
  7. ^ a b Holland, W. J. (1931). The Butterfly book. Garden City, New York: Dubleday, Doran & Company, INC. 
  8. ^ Gibbs, G. W. (1980). New Zealand butterflies identification and natural history. Auckland, New Zealand: Collins. 
  9. ^ a b Klots, Alexander B. (1951). A Field guide to the Butterflies of North America, East of the Great Plains. Cambridge: The Riverside Press. 
  10. ^ a b c Richards, O. W. (November 1940). "The Biology of the Small White Butterfly (Pieris rapae), with Special Reference to the Factors Controlling its Abundance". Journal of Animal Ecology. 2 9: 243–288. doi:10.2307/1459. 
  11. ^ Agrawal, AA & NS Kurashige (2003). "A Role for Isothiocyanates in Plant Resistance Against the Specialist Herbivore Pieris rapae". Journal of Chemical Ecology 29 (6): 1403–1415. doi:10.1023/A:1024265420375. 
  12. ^ editors, J. Richard and Joan E. Heitzman ; Jim Rathert, principal photographer ; Kathy Love and LuAnne Larsen, (1996). Butterflies and moths of Missouri. Jefferson City, MO: Missouri Dept. of Conservation. ISBN 1-887247-06-8. 
  13. ^ Fullard, James H. & Napoleone, Nadia (2001): Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera. Animal Behaviour 62(2): 349–368. doi:10.1006/anbe.2001.1753 PDF fulltext
  14. ^ a b New, T.R. (1997). Butterfly conservation (2nd ed. ed.). South Melbourne: Oxford University Press. ISBN 0-19-554124-3. 
  15. ^ a b Maurico, Rodney; M. Deane Bowers (1990). "Do caterpillars disperse their damage?: larval foraging behavior of two specialist herbivores, Euphrydryas phaeton (Nymphalidae) and Pieris rapae (Pieridae)". Ecological Entomology 15: 153–161. 
  16. ^ a b c Hwang, Shaw-Yhi; Liu, Cheng-Hsiang; Shen, Tse-Chi (1 July 2008). "Effects of plant nutrient availability and host plant species on the performance of two Pieris butterflies (Lepidoptera: Pieridae)". Biochemical Systematics and Ecology 36 (7): 505–513. doi:10.1016/j.bse.2008.03.001. 
  17. ^ a b Davis, C. R.; N. Gilbert (1985). "A comparative study of egg-laying behaviour and larval development of Pieris rapae L. and P. brassicae L. on the same host plants". Oecologia 67: 278–281. 
  18. ^ a b c Omura, Hisashi; Keiichi Honda; Nanao Hayashi (6 April 1999). "Chemical and chromatic bases for preferential visiting by the cabbage butterfly, Pieris rapae, to rape flowers". Journal of Chemical Ecology. 8 25: 1895–1905. 
  19. ^ Honda, Keiichi; Omura, H. and Hayashi, N. (13 August 1998). "Identification of Floral Volatiles from Lingustrum japonicum that Stimulate Flower Visiting by Cabbage Butterfly, Pieris rapae". Journal of Chemical Ecology. 12 24: 2167–2180. 
  20. ^ Lewis, Alcinda C. (16 May 1986). "Memory Constraints and Flower Choice in Pieris rapae". Science. 4752 232: 863–865. doi:10.1126/science.232.4752.863. 
  21. ^ a b c d e Renwick, J. A. A.; Celia D. Radke (1988). "Sensory cues in host selection for oviposition by the cabbage butterfly, Pieris rapae". Journal of Insect Physiology. 3 34: 251–257. doi:10.1016/0022-1910(88)90055-8. 
  22. ^ a b c Ikeura, Hiromi; Kobayashi, Fumiyuki; Hayata, Yasuyoshi (1 December 2010). "How do Pieris rapae search for Brassicaceae host plants?". Biochemical Systematics and Ecology 38 (6): 1199–1203. doi:10.1016/j.bse.2010.12.007. 
  23. ^ a b Root, Richard B.; Peter M. Kareiva (February 1984). "The search for resources by cabbage butterflies (Pieris rapae): ecological consequences and adaptive significance of Markovian movements in a patchy environment". Ecology. 1 65: 147–165. doi:10.2307/1939467. 
  24. ^ Renwick, J. A. A.; Celia D. Radke (1983). "Chemical recognition of host plants for oviposition by the Cabbage butterfly, Pieris rapae (Lepidoptera: Pieridae)". Environmental Entomology 12: 446–450. 
  25. ^ a b Miles, Carol I.; Campo, Marta L. del; Renwick, J. Alan A. (3 December 2004). "Behavioral and chemosensory responses to a host recognition cue by larvae of Pieris rapae". Journal of Comparative Physiology A 191 (2): 147–155. doi:10.1007/s00359-004-0580-x. 
  26. ^ a b c d e f Dempster, J.P. (1967). "The Control of Pieris rapae with DDT. I. The Natural Mortality of the Young Stages of Pieris". Journal of Applied Ecology 4 (2): 485–500. doi:10.2307/2401350. 
  27. ^ a b c Kingsolver, Joel G. (October 2000). "Feeding, growth, and the thermal environment of Cabbage White caterpillars, Pieris rapae L.". Physiological and Biochemical Zoology. 5 73: 621–628. doi:10.1086/317758. 
  28. ^ a b c Ashby, J; Pottinger (1974). [: http://dx.doi.org/10.1080/00288233.1974.10421002 "R"]. New Zealand journal of agricultural research 17 (2): 229–239. doi:10.1080/00288233.1974.10421002. Retrieved 14 April 2014. 

Further reading[edit]

  • Asher, Jim et al.: The Millennium Atlas of Britain and Ireland. Oxford University Press.
  • Evans, W.H. (1932): The Identification of Indian Butterflies (2nd Ed.). Bombay Natural History Society, Mumbai, India.
  • "Pieris rapae". Integrated Taxonomic Information System. Retrieved 6 February 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Palaearctic species complex member.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!