Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Brief Summary

The cabbage white butterfly (Pieris rapae), also known as the cabbage butterfly and the imported cabbageworm, is so named because the larval stage feeds on members of the cabbage family (Cruciferae). This species is found around the world in temperate climates. It was introduced to North America in the 1860's and has since spread throughout the continent. The cabbage white butterfly is known to pollinate several species in the United States.

The cabbage white butterfly has a black body with white wings. The upper wings have a black band at the tip and a black spot in the center of each upper wing. Males have one spot on each wing and females have two. The underneath of the wings are yellowish-green. These butterflies have a wingspan of 30 to 50 mm. Caterpillars are green or bluish-green with a light yellow stripe.

  • Species Pieris rapae - Cabbage White (Bugguide, Iowa State University Entomology)
  • Species Detail: Cabbage White - Pieris rapae (Linnaeus, 1758) (Butterflies and Moths of North America, Big Sky Institute, Montana State University)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 2 people

Average rating: 5.0 of 5

North American Ecology (US and Canada)

Resident throughout North America with migrants north (Scott 1986). Habitats are TOWNS, SOME VALLEY BOTTOMS. Host plants are usually herbaceous including species from many families, including Cruciferae. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There is a variable number of flights based on latitude each year with the approximate flight time JUN1-JUL1 in the northern part of the range and APR15-OCT15 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This widespread and familiar white butterfly is one of the most common butterflies in Europe (5). As the name suggests, adults have whitish upper wings. The forewings have black tips and the undersides of the wings are bright yellow, featuring blackish scales. Males and females are easy to distinguish, as females have two prominent black spots and a blackish streak on the forewing (2). The caterpillar has a green body with black spots and fine hairs. A thin yellowish line extends along the centre of the back and the spiracles are bordered with yellow (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The small white is typically a double-brooded species, with two generations each year. The eggs, which hatch after around one week, are laid in April and then again in June. The female deposits them singly on the underside of leaves of the foodplants (3). Cultivated brassicas such as cabbages and nasturtium are preferred, although wild brassicas including wild cabbage, hedge mustard and wild mignonette are also used (4). The caterpillars tend to feed on the hearts of cabbages, not on the outer leaves. They are solitary and are fully grown after one month. They then undergo pupation; the pupa is attached either to the foodplant or to fences and other structures. Adults emerge from the pupae of the first generation after roughly three weeks, but the pupae belonging to the second generation overwinter, with adults emerging the following spring. In years when the weather is particularly clement, a third brood may occasionally be produced (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

General Description

This is the only species of white which has both unmarked hindwing undersides and at least one black spot on the forewing upperside and the leading edge of the hindwing upperside. Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Size: 46-55 mm. A small version of Pieris brassicae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Cabbage White was introduced from Europe to Quebec in the 1860's (Layberrry et al. 1998), and has since spread over all of North America with the exception of the Arctic and some of the extreme southern parts of the U.S. (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

61 records. Latest in 2006 (oases)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO = 184 km2. EOO = 243,000 km2. 9 locations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (Palaearctic; introduced worldwide)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Introduced into North America south of the Arctic. Rare in southern Florida and in southern Gulf states. Also occurs in Africa, Eurasia, and Japan.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The small white has a wide distribution in Britain, but it becomes scarce in the Scottish Highlands. The distribution of this species seems to have stayed fairly stable, however numbers are thought to have dropped following the introduction of insecticides in the 1950s (4). Elsewhere, this butterfly is found throughout Europe and north-west Africa, reaching Asia as far east as Japan (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Ubiquitous throughout the province, particularly near agricultural habitats.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Always associated with cultivation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mostly disturbed open areas but also invading natural situations. In wooded areas mostly in spring before the canopy closes but seems to be becoming more forest adapted as garlic mustard increases explosiovely in the East.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in a range of habitats, where the food plants (such as cabbage, nasturtium and related plants) occur (3). Typical habitats include fields, gardens, and waste land, although they are often found in smaller numbers in woodland edges, hedgerows and other sheltered places (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Larvae sometimes reach pest status on cultivated mustards such as cabbage, broccoli, cauliflower and canola. A large number of Brassicaceae have been recorded as hosts, particularly introduced, weedy species (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Host-plants: Cultivated brassicas (Cruciferae), especially cabbages; nasturtiums (Tropaeoleum majus) in gardens; wild crucifers and Reseda lutea (Resedaceae).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Pieris rapae in Illinois

Pieris rapae Linnaeus: Pieridae, Lepidoptera
(observations are from Robertson, Graenicher, Wiggam & Ferguson, Betz et al., Hilty, Lewis, Catling, Larson & Barrett, Conger, and Willson & Bertin; this butterfly is the Cabbage White)

Acanthaceae: Justicia americana sn (Rb, Cng); Apiaceae: Sium suave sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] [plup sn] (Rb, Btz), Asclepias verticillata [plab sn] [plup sn fq] (Rb, WB); Asteraceae: Anthemis cotula sn (Gr), Arctium lappa sn (Gr), Arctium minus sn (Rb), Aster anomalus sn (Rb), Aster drummondii sn (Gr), Aster ericoides sn (Rb), Aster furcatus sn (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb, Gr), Aster lateriflorus sn (Gr), Aster novae-angliae sn (Gr), Aster pilosus sn (Rb, H), Aster prenanthoides sn (Gr), Aster puniceus sn (Gr), Bidens aristosa sn (Rb), Bidens bipinnata sn (Rb), Boltonia asterioides sn (Rb), Cirsium altissimum sn (Gr), Cirsium arvense sn (Gr), Coreopsis palmata sn (Rb), Echinacea purpurea sn (Rb), Eupatoriadelphus purpureus sn (Rb, Gr), Eupatorium perfoliatum sn (Gr), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn (Gr), Helenium autumnale sn (Gr), Helianthus annuus sn (Rb), Helianthus giganteus sn (Gr), Helianthus strumosus sn (Gr), Leucanthemum vulgare sn (Lw), Liatris aspera sn (H), Liatris pycnostachya sn (Rb), Liatris spicata sn (Gr), Oligoneuron rigidum sn (H), Rudbeckia hirta sn (Rb), Silphium integrifolium sn (H), Silphium perfoliatum sn (Rb), Vernonia fasciculata sn (Rb); Boraginaceae: Buglossoides arvense sn (H), Lithospermum canescens sn (Rb); Brassicaceae: Barbarea vulgaris sn (H, Lw), Cardamine bulbosa sn (Rb); Campanulaceae: Lobelia spicata sn (Rb), Triodanis perfoliata sn (Rb, Lw); Caryophyllaceae: Stellaria media sn (Lw); Fabaceae: Crotalaria sagittalis sn np (Rb), Lotus corniculatus sn np (Lw), Trifolium pratense sn (Rb, Lw), Trifolium repens sn (Rb, Lw); Fumariaceae: Dicentra cucullata sn np (Rb); Lamiaceae: Agastache nepetoides sn (Rb), Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Glechoma hederacea sn np (Rb), Mentha arvensis sn (Rb), Nepeta cataria sn (Rb), Prunella vulgaris sn (Rb, Lw), Pycnanthemum pilosum sn (H), Pycnanthemum tenuifolium sn (Rb), Scutellaria incana sn np (H), Teucrium canadense sn (Cng); Liliaceae: Allium cernuum sn (Gr), Erythronium albidum sn (Rb), Nothoscordum bivalve sn (Rb), Smilacina stellata sn (Gr), Tofieldia glutinosa sn (Gr); Lythraceae: Lythrum alatum sn (Rb); Malvaceae: Abutilon theophrastii sn (Rb), Hibiscus trionum sn (Rb), Malva neglecta sn (Rb), Sida spinosa sn fq (Rb); Melastomataceae: Rhexia virginica exp np (LBt); Orchidaceae: Spiranthes lacera sn np (Ct); Oxalidaceae: Oxalis corniculata sn (Rb), Oxalis stricta sn (Rb, Lw); Papaveraceae: Sanguinaria canadensis exp (Gr); Parnassiaceae: Parnassia glauca sn (Gr); Polemoniaceae: Phlox divaricata laphamii sn (WF); Polygonaceae: Fallopia scandens sn (Rb), Persicaria pensylvanica sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Fragaria virginiana sn (Rb), Potentilla argentea sn (Lw), Potentilla recta sn (Lw); Rubiaceae: Cephalanthus occidentalis sn (Rb), Houstonia lanceolata sn (Rb); Scrophulariaceae: Agalinis tenuifolia sn np (Rb), Dasistoma macrophylla sn np (Rb), Linaria vulgaris sn np (Rb), Veronicastrum virginicum sn (Rb); Verbenaceae: Verbena stricta sn fq (Rb, H), Verbena urticifolia sn (Rb); Violaceae: Viola cucullata sn (Rb), Viola pedata sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Pieris rapae

Animal / parasitoid / endoparasitoid
larva of Epicampocera succincta is endoparasitoid of larva of Pieris rapae

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Pieris rapae

Foodplant / internal feeder
caterpillar of Pieris rapae feeds within live heart of Brassica oleracea var. capitata

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Occurs in multiple generations from April into September.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Like other Pieris species, the eggs are yellow and conical, with longitudinal ridges. Mature larvae are green with a pale dorsal stripe, and pupae range in colour from brown to green (Guppy & Shepard 2001). The first Cabbage Whites usually emerge in late April from hibernating pupae. There are usually three generations per year in Alberta (Bird et al. 1995). Up to four occur in southern BC, with development time of each generation varying from 4 to 8 weeks according to temperature (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Flight Period

March-October

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Two or more generations per year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These butterflies are one of the first to be seen in the spring and one of the last to be seen in the fall. These butterflies can fly from February to mid-November; they have a shorter season in their northern range and a longer season in the south. Females produce between 300 and 400 eggs; each is laid singly on the underside of host plants. Caterpillars hatch and feed on plants from the cabbage family (Brassicaceae). They then molt five times before turning into a chrysalis. Chrysalids hibernate and hatch into adult butterflies. Adults live about three weeks. Cabbage white butterflies have between two and eight generations per year.

  • Species Pieris rapae - Cabbage White (Bugguide, Iowa State University Entomology)
  • Species Detail: Cabbage White - Pieris rapae (Linnaeus, 1758) (Butterflies and Moths of North America, Big Sky Institute, Montana State University)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Reflectance causes white color: cabbage butterfly
 

The wings of the cabbage butterfly are white due to longitudinal ridges and cross-ribs studded with ovoid beads.

     
  "The small white, Pieris rapae, offers an interesting example of the biology of wing coloration. Both sexes of this butterfly species are rather featureless for human eyes, except for slight differences in the black spots, small wing areas where the wing scales contain melanin. The white color is caused by strongly scattering structures in the wing scales (Stavenga et al., 2004). The reflectance is only high above 450 nm, but it is minor below 400 nm, because the scales of male P. rapae crucivora contain a substantial amount of UV-absorbing pteridins." (Stavenga and Arikawa 2006:314)

"Fig. 7. Coloration of pierid butterflies...(b) The wing scales are marked by longitudinal ridges and cross-ribs. (c) The cross-ribs are studded with ovoid beads...(d) The wing scales strongly scatter, but due to pteridin pigment, which strongly absorbs in the UV, the reflectance is low in the UV." (Stavenga and Arikawa 2006:315)
  Learn more about this functional adaptation.
  • Stavenga, D.G.; Arikawa, K. 2006. Evolution of color and vision of butterflies. Review. Arthropod Structure & Development. 35: 307-318.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pieris rapae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 115 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACTAACCATAAAGATATTGGAACTTTATATTTTATCTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGAACTGAATTAGGAAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAAAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTACTTTTACTATTATCATTACCAGTTCTAGCAGGAGCCATTACAATACTTTTAACAGACCGAAATTTAAATACCTCATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTTTACATTTTAATTTTACCGGGATTTGGAATAATTTCTCATATTATTTCACAAGAAAGTGGGAAAAAGGAAACTTTTGGTTCTTTAGGAATAATTTATGCCATAATAGCAATTGGTCTTTTAGGGTTTATTGTATGAGCTCATCATATATTCACAGTTGGTATAGATATTGATACTCGAGCATATTTTACATCAGCTACAATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTAGCAACTCTTTATGGAACTCAAATTAATTACAGACCTTCAATATTATGAAGATTAGGATTTGTTTTCTTATTTACTGTTGGAGGTTTAACCGGAGTAATTTTAGCAAATTCTTCTATTGATATTATCCTTCATGACACATATTATGTTGTAGCACATTTTCACTATGTTTTATCTATAGGAGCTGTATTTGCTATTTTAGGAGGATTTATCCATTGATACCCACTTTTTACTGGATTAAGATTAAATAATTATTATTTAAAAATTCAATTTATTGTAATATTTATTGGGGTTAACTTAACTTTTTTCCCTCAACATTTCTTAGGATTAGCTGGAATACCTCGACGATACTCAGATTACCCAGATAATTACTTATCTTGAAATATTGTTTCATCATTAGGATCTTATATTTCTTTAATTGCAACAATTATAATAATAATAATCATTTGAGAGTCAATAATCAATCCTCGAATAATCATTTTTTCATTAAATATACCTTCTTCAATTGAATGATACCAAAATCTTCCGCCAGCAGAACATTCTTATAATGAATTACCAATTATAAGTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pieris rapae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 115
Specimens with Barcodes: 286
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident and migrant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Abundant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not threatened (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None, widespread common economic pest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

Recent research has shown that it is actually four times more efficient at pollinating wild radish (Raphanus raphanistrum) than honey bees (Apis mellifera) because honey bees are foraging for both pollen and nectar and most likely groom away pollen from their bodies. In addition to wild radish, cabbage white butterflies are pollinators of red clover (Trifolium pratense), common dandelion (Taraxacum officinale), black-eyed susan (Rudbeckia hirta), buttonbush (Cephalanthus spp.), bird's-foot violet (Viola pedata), and wild strawberry (Rosaceae).

In addition to being pollinators, this species can be considered a pest because the larvae feed on the foliage of crop plants like broccoli, Brussels sprouts, cabbage, cauliflower, collard, horseradish, kale, and kohlrabi. Larvae of this species have the ability to reduce mature plants to stems and large veins by eating foliage. Larvae have also been known to burrow into the heads of broccoli and cabbage; they are difficult to dislodge and produce large amounts of fecal material.

  • The Effect of Wild Radish Floral Morphology on Pollination Efficiency by Four Taxa of Pollinators, J. K. Conner, R. Davis, and S. Rush, Oecologia, Vol. 104, No. 2 (1995), pp. 234-245
  • Cabbage White (Pieris rapae) (Fairfax County Public Schools); Featured Creatures: Imported Cabbageworm, John L. Capinera, University of Florida, Institute of Food and Agricultural Science
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Pest of brassica crop

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pieris rapae

The Small White (Pieris rapae) is a small- to medium-sized butterfly species of the Yellows-and-Whites family Pieridae. It is also known as the Small Cabbage White and in New Zealand, simply as White Butterfly.[1] The names "Cabbage Butterfly" and "Cabbage White" can also refer to the Large White.

It is widespread and populations are found across Europe, North Africa, Asia, and Great Britain. It has also been accidentally introduced to North America, Australia and New Zealand where it causes damage to cultivated cabbages and other mustard family crops. The caterpillar stage alone is responsible for crop damage because of which it is referred to as the Imported Cabbageworm.

Contents

Description

Feeding on nectar

In appearance it looks like a smaller version of the Large White (Pieris brassicae). The upperside is creamy white with black tips to the forewings. Females also have two black spots in the center of the forewings. Its underwings are yellowish with black speckles. It is sometimes mistaken for a moth due to its plain-looking appearance. The wingspan of adults is roughly 32–47 mm (1.25–2 in).[2]

Distribution

The species has a natural range across Europe, Asia and North Africa. It spread across the Atlantic into Canada and the United States beginning somewhere around 1860.[3] It spread to Hawaii by 1898, and Australia in 1929 around Melbourne and spreading across to Perth by 1943.

The nominate subspecies P. r. rapae is found in Europe while the Asian populations are placed in the subspecies P. r. crucivora. Other subspecies include atomaria, eumorpha, leucosoma, mauretanica, napi, novangliae, and orientalis.

Life cycle

In Britain, it has two flight periods, April–May and July–August, but is continuously-brooded in North America, being one of the first butterflies to emerge from the chrysalis in spring, flying until hard freeze in the fall.

Its caterpillars can be a pest on cultivated cabbages, kale, radish, broccoli, and horseradish but it will readily lay eggs on wild members of the cabbage family such as Charlock (Sinapis arvensis) and Hedge mustard (Sisybrium officinale). The eggs are laid singularly on foodplant leaves. It has been suggested that isothiocyanate compounds in the family Brassicaceae may have been evolved to reduce herbivory by caterpillars of the Small White.[4]

Traditionally known in the United States as the Imported Cabbage Worm, now more commonly the Cabbage White, the caterpillars are green and well camouflaged. Caterpillars rest on the undersides of the leaves, thus making them less visible to predators. Unlike the Large White, they are not distasteful to predators like birds. Like many other "White" butterflies, they hibernate as a pupa. It is also one of the most cold-hardy of the non-hibernating butterflies, occasionally seen emerging during mid-winter mild spells in cities as far north as Washington D.C.

Like its close relative the Large White this is a strong flyer and the British population is increased by continental immigrants in most years. Adults are diurnal and fly throughout the day, except for early morning and evening. Although there is occasional activity during the later part of the night, it ceases as dawn breaks.[5]

References

  1. ^ RR Scott & RM Emberson (compilers) (1999). Handbook of New Zealand Insect Names. Entomological Society of New Zealand. ISBN 0-9597663-5-9. http://www.ento.org.nz/Handbook_Insect_Names/Handbook_insect_names.php.
  2. ^ http://www.cbif.gc.ca/spp_pages/butterflies/species/CabbageWhite_e.php
  3. ^ Scudder, SH (1887). "The introduction and spread of Pieris rapae in North America, 1860-1886". Memoirs of the Boston Society of Natural History 4 (3): 53–69. http://www.archive.org/stream/cihm_14771#page/n4/mode/1up.
  4. ^ Agrawal, AA & NS Kurashige (2003). "A Role for Isothiocyanates in Plant Resistance Against the Specialist Herbivore Pieris rapae". Journal of Chemical Ecology 29 (6): 1403–1415. doi:10.1023/A:1024265420375.
  5. ^ Fullard, James H. & Napoleone, Nadia (2001): Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera. Animal Behaviour 62(2): 349–368. doi:10.1006/anbe.2001.1753 PDF fulltext

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Palaearctic species complex member.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!