Overview

Brief Summary

Biology

This butterfly lays its eggs on members of the pea family, particularly meadow vetchling, tufted vetch, greater bird's-foot-trefoil, common bird's-foot-trefoil and bitter-vetch. The eggs are laid in May, when the first brood of butterflies are on the wing, and they hatch in July. The wood white caterpillar is green with small black dots and has darker green stripes edged with yellow. The male butterfly is more likely to be seen flying than the female. He searches for suitable mates along woodland rides and around the edges of scrub. Females spend most of their time feeding from flowers and, when the male finds a female, he performs a courtship display, nodding his head to and fro with his long tubular tongue extended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The wood white butterfly is a rather delicate-looking species, often overlooked along with other members of the white butterfly family. It is creamy-white with grey tips to the upper-forewings, and has grey veins on both upper and hindwings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

In the UK, this species is found largely in scattered populations in the south of England and in Ireland. It is more widespread in Europe, as far as latitude 66ºN in Scandinavia, and its range extends eastwards to the Caucasus Mountains and Siberia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The wood white seems to show a preference for rough, un-managed pastures and shaded woodland edges, although it also occurs around coastal cliffs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Leptidea sinapis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 130
Specimens with Barcodes: 188
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Leptidea sinapis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTTATCTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGAT---GATCAAGTTTATAATACTATTGTTACTGCTCATGCTTTTATCATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATACTTGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTCTGAATACTCCCCCCCTCTCTTTTAATTTTAATTACAAGAAGTGTAGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCGCTTTCATCTAATATTGCTCATAGAGGATCATCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTCTTGGGGCAATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCCGTAGGAATTACAGCTTTATTACTTTTATTATCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTACTCACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGGGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGGCACCCTGAAGTTAATATTCTTATTCTACCAGGATTTGGGATAATTTCACATATTATTACCCAAGAAAGAGGAAAAAAAGAAACATTTGGATCATTAGGAATAATTTATGCTATAATAGCAATTGGGTTATTAGGATTCATTGTATGAGCTCATCATATATTTACAGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

UK BAP status: Species of Conservation Concern. European threat status: not threatened. Protected in Great Britain for sale only.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although never more than locally common, the wood white butterfly has declined severely over much of its UK range, especially in the north where it once occurred in much larger numbers. The main reasons are thought to be loss of the un-managed woodland habitat, greater levels of shade in woods and inappropriate management of woodland rides. The butterfly does not establish new colonies easily, and will not fly between isolated patches of suitable habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Although there is no UKBAP action plan for the wood white, it has been identified as a Species of Conservation Concern. A number of conservation organisations, including Butterfly Conservation and English Nature, have prepared an action plan detailing the problems associated with this species. The principle concerns are to limit the decline of the butterflies' populations and to research suitable woodland management for this species. Isolated colonies that are at risk of local extinction require special attention to ensure their survival.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leptidea sinapis

The wood white (Leptidea sinapis), is a butterfly of the Pieridae family.

Distribution and ecology[edit]

Leptidea sinapis.Habitat Osterwiese auf dem Hesselberg, Germany

It is found in Europe and eastwards across the Caucasus, Asia Minor, the Middle East, Middle Asia, Kazakhstan and South Siberia to the Baikal region.

Geographical variation is slight but the following subspecies are recognized: spp. sinapis (Linnaeus, 1758) European (type locality Sweden, W. Siberia, the S. Altai; ssp. pseudodiniensis (Pfeiffer, 1927) the Caucasus, Kopet-Dagh; ssp. melanoinspersa Verity, 1911 W. and N. Tian-Shan, Dzhungarsky Alatau, Alay Mountains. There is an uncertainly ranked form from Darvaz.

The insect is found in meadows, forest edges and sparse forests up to 2,500m above sea level. The adult flies from April–October in two, sometimes three, generations. Host plants in Europe (Eckstein, 1913; Lorkovic, 1947; Ebert, 1991): Fabaceae (Lathyrus pratensis, Lotus corniculatus, Vicia spp.).

Similar species[edit]

Leptidea sinapis1.jpg

Leptidea sinapis is one of three species in a cryptic species complex. The other members are Leptidea reali and Leptidea juvernica.[1] Similar species are Lepidea morsei Leptidea duponcheli, L. amurensis.

British Isles[edit]

Once a common and widespread butterfly across the southern half of the UK, this species has seen a drastic decline over the past 150 years. It is now found only in a few scattered colonies in Herefordshire, Worcestershire, Northamptonshire, Buckinghamshire, Devon, Surrey and Somerset. Until 2001, Wood Whites were thought to be much more common and widespread in Ireland than in England and were thought to be expanding their range there. However, it is now known that the vast majority are the almost identical species Réal's Wood White Leptidea reali. L. sinapis is only found in the Burren region in the west of Ireland. It is Britain's smallest and rarest white butterfly and has a slow, delicate flight. Rarely, if ever, this species can be seen on treeless, unforested areas. The upperside is white with greyish tips to the forewings but they never settle with their wings open. The underside is a pale greyish green and serves as a good camouflage when settled. It has one main flight period in a season, late may to June but in warm summers a partial second shorter one occurs in August.

Life History[edit]

The female lays her eggs on various members of the pea family in late May and June, most commonly Meadow Vetchling Lathyrus pratensis, bitter vetch Lathyrus linifolius, Tufted Vetch Vicia cracca and Birds-foot Trefoil Lotus corniculatus. The larvae are green and well camouflaged on their foodplant. Pupation takes place at the end of July in surrounding scrub and it is this stage which overwinters.

Egg

References and external links[edit]

  1. ^ Vlad Dincă, Vladimir A. Lukhtanov, Gerard Talavera, and Roger Vila 2011, Unexpected layers of cryptic diversity in wood white Nature Communications, doi:10.1038/NCOMMS1329 [1]

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!