Overview

Brief Summary

North American Ecology (US and Canada)

Resident on small range in interior California (Scott 1986). Habitats are HUDSONIAN ZONE MEADOW. Host plants are usually shrubs in family SALICACEAE. There is one flight each year with the approximate flight time JUL15-AUG15 (Scott 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (<100-250 square km (less than about 40-100 square miles)) Restricted to the Sierra Nevada at high altitudes, mainly above 9000', between Tuolumne and Tulare Counties, California (Ferris, 1988; Opler, 1999). Northernmost point of distribution is near Tower Peak at the northern boundary of Yosemite National Park (Opler, personal observation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sierra Nevada Forests

The Limestone salamander is a highly localized endemic of the Sierra Nevada forests foothills conifned to a limited reach of the Merced River. The Sierra Nevada forests are the forested areas of the Sierra Nevada Mountains, which run northwest to southwest and are approximately 650 kilometers long and 80 km wide. The range achieves its greatest height towards the south, with a number of peaks reaching heights of over 4000 meters. Several large river valleys dissect the western slope with dramatic canyons. The eastern escarpment is much steeper than the western slope, in general.

The Sierra Nevada forests ecoregion harbors one of the most diverse temperate conifer forests on Earth displaying an extraordinary range of habitat types and supporting many unusual species. Fifty percent of California's estimated 7000 species of vascular plants occur in the Sierra Nevada, with 400 Sierra endemics and 200 rare species. The southern section has the highest concentration of species and rare and endemic species, but pockets of rare plants occur throughout the range.

Sierra Nevada amphibian endemics are the Yosemite toad, Mount Lyell salamander (Hydromantes platycephalus), the Vulnerable Limestone salamander (Hydromantes brunus), Kern salamander and the Endangered Inyo Mountains salamander (Batrachoseps campi). The non endemic amphibians are: the Endangered Southern mountain yellow-legged frog (Rana muscosa); the Near Threatened Cascades frog (Rana cascadae); Northern red-legged frog (Rana aurora); Pacific chorus frog (Pseudacris regilia); Foothill Yellow-legged frog (Rana boylii); Long-toed salamander (Ambystoma macrodactylum); and the Monterey ensatina (Ensatina eschscholtzii).

A considerable number of mammalian taxa are found in the ecoregion, including the Long-eared chipmunk, Alpine chipmunk, Western heather vole, Walker Pass pocket mouse, and the Yellow-eared pocket-mouse. A diverse vertebrate predator assemblage once occurred in the ecoregion including Grizzly bear (Ursus arctos), Black bear (Ursus americanus), Coyote (Canis latrans), Mountain lion (Puma concolor), Ringtail (Bassariscus astutus), Fisher (Martes pennanti), Pine marten (Martes americana) and Wolverine (Gulo gulo).

There are a small number of reptilian taxa present in the Sierra Nevada forests: sagebrush lizard (Sceloporus graciosus); Northern alligator lizard (Elgaria coerulea); Southern alligator lizard (Elgaria multicarinata); Sharp-tailed snake (Contia tenuis); California mountain kingsnake (Molothrus ater); Common garter snake (Thamnophis sirtalis); Couch's garter snake (Thamnophis couchii); Western gopher snake (Pituophis catenifer); Longnose snake (Rhinocheilus lecontei); and the Common kingsnake (Lampropeltis getula).

A number of bird species are found in the ecoreion including high level predators that include several large owls, hawks and eagles. Other representative avifauna species present are the Blue-headed vireo (Vireo solitarius); Brown-headed cowbird (Molothrus ater); and the Near Threatened Cassin's finch (Carpodacus cassinii).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Moist alpine and subalpine meadows surrounded by low shrubs including those of the caterpillar host plants shrub willow or dwarf billberry (VACCINIUM CESPITOSUM)(Garth and Tilden, 1963; Scott, 1986; Opler, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Caterpillars eat the leaves of shrub willow or dwarf billberry (VACCINIUM CESPITOSUM)(Garth and Tilden, 1963; Scott, 1986; Opler, 1999). Adults nectar at various low flowers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Adults have a single flight in July and August (Ferris, 1988). Winter is passed by young caterpillars. The possibility exists that as for many alpine and subalpine species, two years may be necessary to complete the life cycle.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colias behrii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCCCCTCTTTCCTCTAATATTGCCCATAGAGGATCTTCTGTTGATTTA---GCTATTTTTTCTCTTCATCTTGCAGGAATTTCCTCTATCCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCATTGCCAGTTTTAGCTGGT---GCAATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACACCCCGAAGTATATATTCTAATTTTACCAGGATTTGGTATAATTTCACATATAATTTCTCAAGAAAGAGGGAAAAAA---GAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGATATTGATACTCGAGCTTATTTCACCTCAGCAACTATAATTATTGCTGTACCTACAGGTATTAAAATTTTTAGTTGATTA---GCAACATTATATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colias behrii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Restricted to high alpine meadows of California's Sierra Nevada. Thus a very limited range. . In general common at high enough altitudes within this tiny range. Some occurrences are protected. Likely to be vulnerable to climate change given shortage of higher refugia and limited range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Summer cattle grazing of US Forest Service lands may be a threat, but usually not so high in elevation. Trampling of meadows by domestic livestock and hikers. Introduction of alien weeds is a less serious threat. Climate change probably is the greatest current threat. This butterfly is already confined to high altitudes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: National Park in part, USFS other parts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colias behrii

The Behr's Sulphur or Sierra Green Sulfur (Colias behrii) is a butterfly in the Pieridae family. It is endemic to California's Sierra Nevada from Tuolumne County south to Tulare County.[2]

The wingspan is 35–42 mm (1.4–1.7 in). The upper surface of the males is dull green with a dark border and with a pale hindwing cell spot. Females are greenish-yellow with a dark diffuse border. The underside of both sexes is green. Adults are on wing from July to August. They feed on flower nectar.[2]

The larvae feed on Vaccinium species and Gentiana newberryi.[2]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!