Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colias behrii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCCCCTCTTTCCTCTAATATTGCCCATAGAGGATCTTCTGTTGATTTA---GCTATTTTTTCTCTTCATCTTGCAGGAATTTCCTCTATCCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCATTGCCAGTTTTAGCTGGT---GCAATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACACCCCGAAGTATATATTCTAATTTTACCAGGATTTGGTATAATTTCACATATAATTTCTCAAGAAAGAGGGAAAAAA---GAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGATATTGATACTCGAGCTTATTTCACCTCAGCAACTATAATTATTGCTGTACCTACAGGTATTAAAATTTTTAGTTGATTA---GCAACATTATATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colias behrii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colias behrii

The Behr's Sulphur or Sierra Green Sulfur (Colias behrii) is a butterfly in the Pieridae family. It is endemic to California's Sierra Nevada from Tuolumne County south to Tulare County.[2]

The wingspan is 35–42 mm (1.4–1.7 in). The upper surface of the males is dull green with a dark border and with a pale hindwing cell spot. Females are greenish-yellow with a dark diffuse border. The underside of both sexes is green. Adults are on wing from July to August. They feed on flower nectar.[2]

The larvae feed on Vaccinium species and Gentiana newberryi.[2]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!