Overview

Brief Summary

The Danube Clouded Yellow occurs in dry, warm grassland where its foodplant, species of the genus Chamaecytisus, are always abundant. However, the amount of shelter from bushes can vary considerably. While the female lays its eggs on the foodplant, the caterpillars hibernate in the litter layer. It has two to three generations a year. The species shows serious declines, especially at the western edge of its range. Within the last years it disappeared most probably from Germany, the Czech Republic, Austria, Hungary, Slovenia and Serbia. Habitats: dry calcareous grasslands and steppes (30%), mesophile grasslands (21%), dry siliceous grasslands (21%), coniferous woodland (8%), mixed woodland (8%).

  • Dolek M, Freese A, Geyer A, Stetter H (2005) The decline of Colias myrmidone at the western edge of its range and notes on its habitat requirements. Biologia 60: 607-610.
  • Freese A, Dolek M, Geyer A, Stetter H (2005) Biology, distribution, and extinction of Colias myrmidone (Lepidoptera: Pieridae) in Bavaria and its situation in other European countries. Journal of Research on the Lepidoptera 38: 51-58.
  • Konvička M, Beneš J, Cizek O, Kopecek F, Konvička O, Vitaz L (2008a) How too much care kills species: Grassland reserves, agri-environmental schemes and extinction of Colias myrmidone (Lepidoptera : Pieridae) from its former stronghold. Journal of Insect Conservation 12: 519-525. doi: 10.1007/s10841-007-9092-7
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colias myrmidone

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAGTATGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCTGGATCACTAATTGGAGATGATCAAATTTATAATAGTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATGCCAATCATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTACTACCCCCATCATTAACTTTATTAATTTCTAGAAGTATTGTTGAAAACGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCCCATAGAGGATCTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTTGCAGGAATTTCCTCTATCCTCGGAGCAATTAATTTTATTACAACAATTATCAATATACGAATTAATAATATGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colias myrmidone

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Threats in Europe

This species is threatened both by intensification and abandonment of semi-natural grasslands, its main habitat. Furthermore, especially for the westernmost parts, climate change is considered as one of the most important reasons for the decline, but it cannot fully explain the situation over this scale. It is certain that in some cases land-use changes even under Agri-Environmental Schemes have led to drastic declines. In general, loss of habitat and habitat connectivity, unfavourable grassland management (wrong timing or intensity) and climate change (less continental climate) must be considered. At this moment abandonment and intensification of grazing and burning are probably the largest threats to the populations in Eastern Europe.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

The species is listed on the Habitats Directive, Annexes 2 and 4. More research is urgently needed on the distribution and ecology of the species. Important habitats should be protected and appropriately managed. The effects of conservation actions should be monitored by a Butterfly Monitoring Scheme. It benefits from proper management of semi-natural grasslands. The species will benefit from the establishment of areas of High Nature Value Farmland. In Hungary the species used to occur only in protected areas. However, there are no recent records from Hungary despite deliberate surveys.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colias myrmidone

The Danube Clouded Yellow (Colias myrmidone) is a butterfly in the Pieridae family. It is found from Western Asia, through Southern Russia, Ukraine, Romania, Hungary up to Austria and the Jura mountains near Regensburg in Germany.

Colias myrmidone, orig. figure from Esper, -1777-, pl. 65.jpeg

The wingspan is 44–50 mm. The butterfly flies in May and again from July to August in two generations.

The larvae feed on Chamaecytisus ratisbonensis, Chamaecytisus ruthenicus and Chamaecytisus supinus.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!