Overview

Brief Summary

North American Ecology (US and Canada)

Resident in northern North America (Scott 1986). Habitats are ARCTIC/ALPINE TUNDRA, especially dry ridges and eskers. Host plants are usually herbaceous with hosts largely restricted to a few species in one family, Leguminosae. Individuals overwinter as young, third-instar and full-grown larvae and are probably biennial.. There is one flight each year with the approximate flight time JUN15-AUG31 (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

This dark, grey-green sulphur, with the underside discal spot streaked towards the outside, is not likely to be confused with any other sulphurs. Unlike all other sulphurs, male Labradors have the forewing dark border broken with pale blotches, a trait usually found only in female sulphurs. Alberta populations are subspecies streckeri, described from Lake Louise. The common name is rather a poor one, since only a small portion of this species' distribution is within Labrador.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

An Arctic - alpine species, occurring from northern Labrador across the arctic to Alaska and south in the western mountains to extreme northern Washington state and Montana (Layberry et al. 1998, Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. In North America, Alaska to British Columbia, south to borders of Washington and Montana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Colias nastes Boisduval, 1832
Catalog Number: USNM USNMENT781063
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male; Adult
Preparation: Pinned
Locality: Labrador, Canada
  • Lectotype: Icones historique des Lepidopteres nouveaux ou peu connus. pl. 8, figs. 4-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Gravelly or rocky alpine tundra.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: High altitudes and barren slopes in arctic regions; tundra.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae feed on Oxytropis splendens on Redcap Mountain near Cadomin (Bird et al. 1995), and likely other alpine legumes. There are no published reports of adult nectar sources.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

One yearly brood, flying between mid July and late August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The immature stages are incompletely known; mature larvae are dark green with a pink-edged lateral stripe (Bird et al. 1995). This species is known for its rapid flight over its rocky and often steep alpine habitat, making it difficult to observe and capture.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colias nastes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTGTGTGGGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTACCCCTGGGTCACTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCCTTTATTATAATTTTTTTCATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTACTCCCCCCATCATTAACTTTATTAATTTCTAGAAGTATTGTCGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCCCATAGAGGATCTTCTGTTGATTTAGCTATTTTCTCTCTTCATCTTGCGGGAATTTCCTCTATCCTAGGAGCAATTAATTTTATTACCACAATTATCAATATACGAATTAATAATATGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colias nastes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colias nastes

The Labrador Sulphur (Colias nastes) is a butterfly in the Pieridae family. In Europe, it is found in the North of Norway and Sweden and on rare occasions in Northern Finland. It is also found in North America, specifically in Alaska, Canada, and the Rocky Mountains, Washington, Montana and on Greenland. In Asia, it is found in the Altai Mountains, the border regions of Russia, China, Mongolia, Kazachstan, the Sayan mountains, the North of Siberia, and in the Chukotka Autonomous Okrug.

Description[edit]

The wingspan is 31–45 mm.C. nastes is dark grey-green with grey-black margins and red fringes. The female is more yellowish and has more distinct yellowish submarginal spots on both wings. The under surface of the forewing is impure whitish, with greenish yellow scales, the rose-red fringes are conspicuous, the hindwing is yellowish green, lighter at the margin, the white median spot is bordered with red and distally to it is placed a diffuse red spot, the rose-red fringes are broader than on the forewing. The female has a somewhat lighter under surface and on the forewing some small black submarginal spots.

Biology[edit]

The butterfly flies in May to August depending on the location.

The larvae feed on Astragalus species, especially Astragalus alpinus and Astragalus frigidus. In North America it is also recorded on Trifolium repens and possibly Vaccinium species.

Subspecies[edit]

  • C. n. nastes Altai, Sayan, Chukot Peninsula, Alaska, Greenland, Labrador, Greenland.
  • C. n. aliaska O. Bang-Haas, 1927 Alaska, Canada (Yukon, Northwest Territories, Victoria Island, Banks Island)
  • C. n. dezhnevi Korshunov, 1996 NE.Siberia (Magadan, Chukotka, Bilibino)
  • C. n. dioni Verhulst, 1999 Canada (Alberta)
  • C. n. jakutica Kurentzov, 1970 Russian Far East (Yakutia)
  • C. n. moina Strecker, 1880 Canada (Northwest Territories, Manitoba)
  • C. n. streckeri Grum-Grshimailo, 1895 Canada (Alberta, British Columbia), N.Washington, Montana
  • C. n. zemblica Verity, 1911 Novaja Zemlja
  • C. n. cocandicides Verity, 1911
  • C. n. ferrisi Verhulst, 2004 Alaska
  • C. n. mongola Alpheraky, 1897

References[edit]

  • Churkin, S., Grieshuber, J ., Bogdanov, P. & Zamolodchikov, D., 2001 Taxonomic notes on Colias tyche Böber, 1812 and Colias nastes Boisduval, 1832 (Lepidoptera, Pieridae) from the Russian Far East with the descriptions of new subspecies. Helios 2: 103-116, pls.8-10.
  • Joseph T. Verhulst (English translation R. Leestmans, editing E. Benton and R. Leestmans), 2000 Les Colias du Globe translation Monograph of the genus Colias Keltern, Germany : Goecke & Evers ISBN 9783931374150
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!