Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Strictly a migratory stray in southern portion of United States, ranges south to Argentina (Scott 1986). Habitats are SUBTROPICAL BRUSH. Host plants are usually shrubs with hosts including species from one family, Leguminosae. Eggs are laid on the host plant singly. Individuals do not overwinter in North America. There are multiple flights each year (Scott 1986), between MAY1-DEC31 in south Texas.
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anteos clorinde

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCTTTAAGATTACTAATTCGAACAGAATTAGGTAACCCTGGGTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTTTATTAATTTCTAGAAGTATTGTTGAAAACGGAGCTGGAACAGGATGAACAGTTTATCCTCCTCTTTCTTCTAATATTGCTCATAGAGGCTCATCAGTAGATTTAGCCATCTTTTCTTTACACTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGAATTACAGCATTATTACTACTTTTATCGTTACCAGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anteos clorinde

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Anteos clorinde

The White Angled-sulphur (Anteos clorinde) is a butterfly of the Pieridae family. It is found in South America, Central America, and southern North America.

White Angled-Sulphur (Anteos clorinde).jpg

The wingspan is 70–90 mm. The butterfly flies year round in the tropical parts of its range and from August to December in the North.

The larvae feed on Senna spectabilis.

Subspecies

The following subspecies are recognised:

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!