Overview

Brief Summary

North American Ecology (US and Canada)

Migratory in southwest North America except the tip of south Texas (Scott 1986). Habitats are SUBTROPICAL OPEN AREAS. Host plants are trees and shrubs from several genera in family ZYGOPHILLACEAE. There are multiple flights each year (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident in southern Arizona, Texas; strays into Florida and the Midwest. Also occurs in tropical America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Arid plains and open places, with its larval host, Porliera angustifolia, and perhaps others in family Zygophyllaceae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Kricogonia lyside

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 58
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Kricogonia lyside

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTATATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATGTTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCACTTACTTTATTAATTTCAAGTAGTATTGTTGAAAACGGAGCAGGAACTGGATGAACAGTTTATCCTCCTCTTTCTTCTAATATTGCTCATAGAGGATCATCAGTTGACTTAGCTATTTTCTCTCTTCATTTAGCGGGAATTTCTTCAATCCTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGTATTAATAATATATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCTTTATTATTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, common neotropical species; in US resident only in southern Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Kricogonia lyside

Kricogonia lyside, commonly known as the Lyside Sulphur or Guayacan Sulphur,[1] is a North and South American butterfly in the family Pieridae. In seasons with heavy monsoons, this butterfly is seen in massive migrations which are frequent in Texas but more rare in the southwest. It is also an occasional resident in southern Florida.

Description[edit]

Lyside Sulphur variation. The top row shows the upper side of the wings and the bottom row shows the underside of the wings.

The Lyside Sulphur is variable. The upper side of the wings is pale yellow, usually with a black bar on the leading edge of the hind wing and a bright yellow patch near the base of the fore wing. Some individuals also have black borders along the costa and apex of the fore wing. The underside of the wings varies from a greenish color to bright yellow to almost white.[2] Greener individuals have a whitish vein in the center of the hind wing and a bright yellow fore wing basal patch.[3] It has a wingspan of 3.8 to 6 cm (1.5 to 2.4 in).[4]

Similar species[edit]

Similar species in the Lyside Sulphur's range include Queen Alexandra's Sulphur (Colias alexandra), the Cloudless Sulphur (Phoebis sennae), and the Statira Sulphur (Aphrissa statira).

Queen Alexandra's Sulphur has more yellow on the underside of the fore wing and has a whitish spot in the center of the hind wing.[5]

The Cloudless Sulphur is larger and is much more yellow.[5]

The Statira Sulphur has a more yellowish upper side and the underside of the wings is pale greenish to white with females having light pinkish markings.[2]

Habitat[edit]

The Lyside Sulphur may be found in open, subtropical scrub.[1]

Flight[edit]

This butterfly is seen almost all year in southern Texas[1] and is seen from early July to mid November in Arizona.[5] In Florida there have been scattered sightings from July to October.[3]

Life cycle[edit]

The larva is highly variable. It ranges in color from grass green to blackish-green. It may have markings or may be unmarked. Marked individuals usually have dorsal and spiracular silvery stripes. It is the only caterpillar to feed on plants in the family Zygophyllaceae.[6] Apparently they feed exclusively on the leaves of three Guaiacum species: G. sanctum and G. angustifolium in Central and North America and G. officinale in South America and the Caribbean.[2][4][7] The chrysalis is a bluish-green color.[1] The Lyside Sulphur can grow from egg to adult in as little as 13 days. It has 3 or more broods per year in southern Texas.[7]

References[edit]

  1. ^ a b c d Scott, James A. (1986). The Butterflies of North America. Stanford, CA: Stanford University Press. ISBN 0-8047-2013-4. 
  2. ^ a b c Brock, Jim P.; Kenn Kaufman (2003). Butterflies of North America. New York, NY: Houghton Mifflin. ISBN 0-618-15312-8. 
  3. ^ a b Cech, Rick; Guy Tudor (2005). Butterflies of the East Coast. Princeton, NJ: Princeton University Press. ISBN 0-691-09055-6. 
  4. ^ a b "Lyside Sulphur Kricogonia lyside (Godart, 1819)". Butterflies and Moths of North America. Retrieved 2010-09-07. 
  5. ^ a b c Stewart, Bob; Priscilla Brodkin and Hank Brodkin (2001). Butterflies of Arizona. West Coast Lady Press. ISBN 0-9663072-1-6. 
  6. ^ Beccaloni, George W.; Ángel L. Viloria.; Stephen K. Hall.; Gaden S. Robinson (2008). Catalogue of the hostplants of the Neotropical butterflies. Catálogo de las plantas huésped de las mariposas neotropicales, Sociedad Entomológica Aragonesa (SEA)/ Red Iberoamericana de Biogeografía y Entomología Sistemática (RIBES)/ Ciencia y Tecnología para el Desarrollo (CYTED) / Natural History Museum, London (NHM) / Instituto Venezolano de Investigaciones Científicas, m3m: Monografías 3ercer Milenio, volumen 8 , Zaragoza, 536 pp., 1 fig. 3 tabls. ISBN 978-84-935872-2-2
  7. ^ a b Allen, Thomas J.; Jim P. Brock and Jeffrey Glassberg (2005). Caterpillars in the Field and Garden. New York, NY: Oxford University Press. ISBN 978-0-19-514987-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: Both sexes highly variable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!