Overview

Brief Summary

Apart from its greater size and slightly falcate forewings the species can be separated from the other Wood Whites in Europe (Leptidea spp.) by the conspicuous gliding flight displayed by the males. Fenton’s Wood White can be seen on damp, grassy vegetation at the sunny edges of woods, in grassy woodland clearings and on regenerating woodland on grassland. They occur almost exclusively in oak forest and mixed deciduous woods. This butterfly has two generations a year and hibernates in the pupal stage. The larvae feed on Peas, in Europe on Lathyrus niger or Lathyrus vernus with ova being laid almost exclusively on the plants in the shade. In Transylvania, an important larval food plant is the endemic Lathyrus hallersteinii. Habitats: broad-leaved deciduous forests (40%), mesophile grasslands (15%), humid grasslands and tall herb communities (10%), coniferous woodland (10%), mixed woodland (10%).

  • Gascoigne-Pees M, Trew D, Pateman J, Verovnik R (2008) The distribution, life cycle, ecology and present status of Leptidea morsei (Fenton 1882) in Slovenia with additional observations from Romania (Lepidoptera: Pieridae). Nachrichten des entomologischen Vereins Apollo, Neue Folge 29: 113-121.
  • Höttinger H (2004) Verbreitung, Ökologie, Gefährdung und Schutz des Senf-Weißlings Leptidea morsei (Fenton, 1881) in Österreich, insbesondere im Burgenland (Lepidoptera, Pieridae). Joannea Zoologie 6: 187-206.
  • Lorković Z (1993) Ecological association of Leptidea morsei major Grund 1905 (Lepidoptera, Pieridae) with the oak forest Lathyreto-quercetum petraeae HR-T 1957 in Croatia. Periodicum Biologorum 95: 455-457.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptidea morsei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATCTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTGGGAAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATCATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATACTAGGAGCTCCAGATATAGCTTTTCCCCGTATAAATAATATAAGTTTCTGAATACTTCCCCCCTCTCTCATAATTTTAATTACAAGAAGTGTAGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCTCATAGAGGGTCATCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCCTCTATTCTTGGAGCAATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTCTATTTGTATGAGCCGTAGGAATTACAGCTTTATTACTTTTATTATCTCTCCCTGTTTTAGCTGGAGCTATTACTATATTACTTACCGACCGAAATTTAAATACATCATTTTTTGACCCAGCAGGGGGAGGAGATCCAATTCTTTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leptidea morsei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Leptidea morsei

Fenton’s Wood White (Leptidea morsei) is a butterfly of the Pieridae family. It is found from central Europe to Siberia, Ussuri, Korea, northern China and Japan.[1] The habitat consists of damp, grassy vegetation at the sunny edges of woods, in grassy woodland clearings and on regenerating woodland on grassland. They occur almost exclusively in oak forest and mixed deciduous woods.

The wingspan is 46–54 mm. Adults are on wing from April to May and again from June to July in two generations per year.[2]

The larvae feed on Peas, including Lathyrus niger, Lathyrus hallersteinii and Lathyrus vernus in Europe. Other recorded food plants include Vicia cracca, Vicia japonica and Vicia amoena. Hibernation takes place in the pupal stage.[3]

Subspecies[edit]

References[edit]

  1. ^ Leptidea at funet
  2. ^ butterfly-guide.co.uk
  3. ^ C. Van Swaay et al. (2012). "Dos and Don'ts for butterflies of the Habitats Directive of the European Union". Nature Conservation 1: 73. doi:10.3897/natureconservation.1.2786. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!