Overview

Brief Summary

Description

This small, common froghopper is variably patterned with brown, black and white (1). The wings are held like a tent over the body (2). It has recently been discovered that this froghopper is the champion jumper of the animal kingdom, able to jump 70 cm into the air. This is a greater height than the flea, yet the froghopper is much heavier, so it has the most impressive jumping style. The back legs used in jumping are so well-developed in this species that they trail behind it when it walks around. The jump is so powerful that in the initial stages a G-force of over 400 gravities is generated. This is truly phenomenal considering that an astronaut rocketing out into orbit experiences G-forces of 5-gravities (3). Young froghoppers, known as nymphs, develop in frothy clumps that are popularly known as cuckoospit (1). Like all bugs (Hemiptera), the froghopper has specialised sucking mouthparts, which in this species are used to feed on plant sap (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Biology

Adults and nymphs are present between June and September (2). As with most bugs, individuals mate 'back to back' (4). All bugs have a type of insect development known as 'hemimetabolous development' in which there is no larval stage but a number of wingless nymphs instead which resemble the adult form (4). The nymphs of this species are protected by their covering of froth, which they create by blowing air into a fluid excreted from their anus. They feed on plant tissues below this protective covering, which also prevents them from drying out (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Common throughout Britain (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found in a wide range of habitats including parks, meadows and gardens on a variety of plants (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Philaenus spumarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 113
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Philaenus spumarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAAAAAATGAATATTCTCTACTAATCACAAAGATATCGGAACTTTATATTTTCTATTTGGGATTTGATCTGGAATAATTGGGACTACTCTAAGATTATTAATTCGGGTTGAATTGGGTCAACCTGGGTCATTTATTGGGGATGATCAAATTTATAATGTAATTGTAACTTCCCATGCTTTTATCATGATTTTTTTTATAGTTATACCAATTATAATTGGTGGTTTTGGAAATTGATTAGTTCCATTAATAATTGGTGCTCCTGACATAGCATTTCCACGAATAAATAATATAAGATTTTGAATGCTTCCTCCTTCATTAACGCTTCTTCTTTCAAGAAGAATAATTGATAATGGAGTAGGGACGGGATGAACAGTTTATCCTCCTTTATCAAGAGGTGTAGCACATGCTGGTGCATGTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCTTCTATTCTAGGTGCTGTAAATTTTATTACTACTATTTTTAATATACGTTCTTCAGGTATGAAAATAGATCGAACTCCTTTATTTGTATGAGCAGTTTTGATTACTACAATTTTACTTTTACTTTCCTTACCAGTCTTGGCTGGAGCTATTACAATGTTATTAACAGATCGAAATATTAATACTTCATTTTTTGATCCGTCGGGGGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTTTTTGGGCACCCAGAGGTTTATATTTTGATTTTACCAGGGTTTGGTTTAATCTCTCATATTATTAGACAAGAAAGAGGAAAAAATGAATCTTTTGGATCTTTAGGTATAATTTATGCTATAATAGCAATTGGTTTGCTAGGTTTCGTGGTTTGAGCTCATCATATATTTACTGTAGGTATAGATGTTGATACACGTGCATATTTTACTTCAGCCACAATAATTATTGCTGTACCCACAGGTATCAAAATTTTTAGTTGATTGGCTACAATACATGGAATACCATTCAAATTGTCTTCTCCTATTTTATGATCAATTGGGTTTGTATTTTTATTTACAATTGGGGGTTTGACAGGAATTGTTTTATCTAATTCTTCTATTGATATTATTCTTCATGATACTTACTATGTAGTAGCTCATTTTCATTATGTATTATCTATAGGGGCAGTATTTGCAATTTTAGGGAGATTTATTCAATGATACCCTTTATTTACTGGATTAACAATGAATTCAAAATGGTTAAAAATACAATTTATAATTATATTTGTTGGGGTGAACCTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGGAATACCTCGTCGATACTCTGATTACCCAGATGCTTACATATCTTGAAATATTTTATCTTCAATTGGAAGAATAATTTCATTTATTGGAATTTTATTATTAATTTTTATTGTTTGAGAAAGATTAATTTCAAAACGAAAAAGAATTTTTTCAAAAAATATAATTTCTTCAATTGAGTGACTCCAAATGATACCCCCATCCGAGCATTCTTATAACGAATTACCAATATTAACTAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This species is not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action is not required for this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Philaenus spumarius

Philaenus spumarius, the 'Meadow Froghopper', is a species belonging to the family Cercopidae. The genus name "Philaenus" comes from the Greek "philein" meaning "love", while the species name "spumarius" is derived by the Latin "spuma" = "sparkling", referred to the foam nests. Therefore "Philaenus spumarius" may be translated as "foam lover."

Distribution[edit]

These 'froghoppers' are quite common and widespread. Their original distribution was restricted to the Palaearctic ecozone. It is present in most of Europe, in North Africa, in part of Russia, in Afghanistan and in Japan. It has been introduced in North America and Canada.

Identification[edit]

The species reaches a body length of 5–7 millimetres (0.20–0.28 in). Most females are slightly larger than the males. The coloration of the body is very variable (about 20 different colors are known). Usually they are yellowish, brownish or black, with brighter patches on a dark background, but also with dark markings on a lighter background.

Habitat[edit]

Philaenus spumarius is a very 'eurytopic' species, meaning that these froghoppers can tolerate a wide range of environmental factors and therefore exist in many different habitats. They live in almost all open land habitats and in open forests. They are absent only in very wet and very dry habitats. They are polyphagous, the host plant specificity is low, so that they can feed on a variety of plants, mainly grasses (Poaceae species), reed plants (Juncaceae species), herbs and sometimes trees. They have been identified on over 170 host plants.[citation needed]

The most common modes of locomotion are running and flying,[citation needed] but the most striking is their strong jumping ability, which is useful for escaping from predators.

Life cycle[edit]

The females lay eggs singly or in groups on the food plants of the larvae. A single female can produce up to 350 to 400 eggs. In unfavorable climatic periods, these froghoppers can survive in the form of eggs.

The larvae are well known for the self-generated foam nests, that can be observed in Spring in meadows (especially on Cuckoo Flowers, Cardamine pratensis and broom, Genista species). Their larvae in the foam nests are largely protected from predators and also get the necessary moisture for the development and temperature, so their mortality remains low even in bad weather. The larval stage lasts about 50 days. The adults leave the foam nest only when it is completely dried. This takes about ten days. The females mate soon after.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!