Ecology

Associations

Fungus / parasite
plant of Monotropa hypopitys parasitises mycorrhiza of Tricholoma
Other: sole host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:647
Specimens with Sequences:616
Specimens with Barcodes:601
Species:119
Species With Barcodes:113
Public Records:475
Public Species:74
Public BINs:0
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Tricholoma cf. japonicum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCAGTGTTAATAAGATTAGAACTATCTTCACCTGGAGTGCAATTTTTACAGGGGAATCATCAGTTATTTAACATGATTATCTCAGCTCATGCCTTTATCATGATATTTTTTATGGTAATGCCTGGTCTAGTTGGTGGATTCGGTAACTATTTTTTACCTCTTCATTGCGGTAGCCCTGATATGGCTTTTCCACGATTGAATAATATATCCTTCTGGTTGCTTCCGCCATCTCTAATTTTACTTTTAATGAGTAGTTTAGTTGAAAATGGAGCTGGAACAGGATGGACGGTATATCCTCCATTATCTGGTATCCAATCACACTCTGGTGGTTCTGTGGATTTAGCTATCTTCAGTCTACATCTTGCTGGGGTTTCTTCTTTATTAGGTGCTATTAATTTCATTAGTACAACACTTAATATGAGAACAAATGGTATGTCATTACATAAGTTACCATTATTTGTGTGGGCTATTTTTATAACAGCTATATTATTGTTATTATCTTTACCCGTTTTAGCAGGTGCCATTACAATGCTTTTACAGATAGAAACTTTAATACAAGCTTTTATGACCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tricholoma cf. japonicum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tricholoma

Tricholoma is a genus of fungus that contains a large number of fairly fleshy white-spored gilled mushrooms which are found worldwide generally growing in woodlands. These are ectomycorrhizal fungi, existing in a symbiotic relationship with various species of coniferous or broad-leaved trees. The generic name derives from the Greek trichos (τριχος) meaning hair and loma (λωμα) meaning fringe or border,[1] although only a few species (such as T. vaccinum) have shaggy caps which fit this description.

Some well-known species are the East Asian Tricholoma matsutake, also known as "matsutake" or songi, and the North American species Tricholoma magnivelare, also known as "ponderosa mushroom", "American matsutake", or "Pine mushroom". Some are safe to eat, yet there are a few poisonous members, such as T. pardinum, T. tigrinum and T. equestre.

Many species originally described within Tricholoma have since been moved to other genera. These include the Wood blewit (Clitocybe nuda), previously Tricholoma nudum, blewit (Clitocybe saeva), previously Tricholoma personatum, and St George's mushroom (Calocybe gambosa) previously Tricholoma gambosum.

Species list[edit]

T. lascivum
T. scalpuratum
T. terreum (or T. myomyces)

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!