Ecology

Associations

Fungus / parasite
sporangium of Spinellus fusiger parasitises fruitbody of Mycena
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mycena cf. pura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCATTCTCGGTACTAATTAGATTAGAGTTAGCTGCACCAGGTCTTCAATTTTTAGCTGGAGATCATCAATTATTTAACGTAATAATATCTGCCCATGCGCTTATTATGATTTTCTTCATGGTTATGCCTGGTCTTGTAGGAGGTTTTGGTAATTACTTCTTACCTGTACAAATGGGTGCACCTGATATGGCATTTCCACGTTTAAATAATATCTCATTTTGATTATTACCTCCTTCACTATTATTACTTTTATTAAGTGCATTAGTAGAAAATGGGGCTGGTACTGGTTGAACGGTATATCCTCCATTATCTGGAATACAATCACACTCCGGAGGTTCAGTTGATTTAGCTATATTTTCTCTACATCTTGCGGGGGTGTCTTCTCTTCTTGGAGCTATTAATTTTATTTCTACAGCTCTAAATATGAGAACTGACGGAATGTTGCTACACAAAATGCCATTATTTTGTTGGTCTATTTTCGTTACCGCTATTTTACTGCTAATTACATTGCCAGTGTTAGCCGGTGCAATTACAATGCTTCTAACTGATAGAAACTTTAATACATCATTCTTTGATCCTGCAGGAGGAGGTGATCCAGTATTGTTTCAACATCTTTCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mycena cf. pura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Mycena cf. purpureofusca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCGGTGCTAATTAGATTAGAATTAGCTGCACCAGGTCTTCAATTTTTAGCTGGAGATCACCAATTATTTAACGTAATAATATCTGCTCATGCGCTTATTATGATTTTCTTCATGGTTATGCCTGGTCTTGTAGGAGGTTTTGGTAATTATTTCTTACCTGTACAAATGGGTGCGCCTGATATGGCATTTCCACGTTTAAATAATATCTCATTCTGATTATTACCTCCTTCACTATTATTACTTTTATTAAGTGCATTAGTAGAAAACGGAGCAGGTACAGGTTGAACGGTATATCCTCCTTTATCCGGAATACAATCACACTCCGGAGGTTCAGTTGATTTAGCTATATTTTCTCTACACCTTGCGGGGGTGTCTTCTCTATTGGGTGCTATTAATTTTATTTCTACAGCCCTAAATATGAGAACTGATGGAATGTTACTACACAAAATGCCATTATTTTGTTGGTCTATTTTCGTTACCGCTATTTTACTGCTAATTACATTGCCTGTATTAGCCGGTGCAATTACAATGCTTCTAACTGATAGAAATTTTAATACTTCATTCTTCGATCCTGCTGGAGGTGGTGATCCTGTATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mycena cf. purpureofusca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 531
Specimens with Sequences: 382
Specimens with Barcodes: 344
Species: 160
Species With Barcodes: 126
Public Records: 198
Public Species: 58
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mycena

Mycena sp.
View the Mycomorphbox template that generates the following list
Mycological characteristics
gills on hymenium
cap is conical
hymenium is adnate
stipe is bare
spore print is white
ecology is saprotrophic
Mycena rubroglobulosa, Wellington, New Zealand.

Mycena is a large genus of small saprotrophic mushrooms that are rarely more than a few centimeters in width. They are characterized by a white spore print, a small conical or bell-shaped cap, and a thin fragile stem. Most are gray or brown, but a few species have brighter colors. Most have a translucent and striate cap, which rarely has an incurved margin. The gills are attached and usually have cystidia. Some species, like Mycena haematopus, exude a latex when the stem is broken, and many have the odor of bleach.

Mycenas are hard to identify to species and some are distinguishable only by microscopic features such as the shape of the cystidia. Some species are edible, while others contain toxins, but the edibility of most is not known, as they are too small to be useful in cooking. Mycena cyanorrhiza stains blue and contains the hallucinogen psilocybin[1] and Mycena pura contains the mycotoxin muscarine.

Over 33 species are known to be bioluminescent,[2][3] creating a glow known as foxfire. These species are divided among 16 lineages, leading to evolutionary uncertainty in whether the luminescence developed once and was lost among many species, or evolved in parallel by several species. What, if any, benefit the fungus derives from the luminescence is uncertain.

Alexander Smith's 1947 Mycena monograph identified 232 species; the genus is now known to include about 500 species worldwide.[4] Maas Geesteranus divided the genus into 38 sections in 1992, providing keys to each for all the species of the Northern Hemisphere. Many new species have been discovered since then, and four new sections have been proposed. Taxonomy is complex, as most sections are not truly homogeneous, and the keys fail for some species, especially those that satisfy some criteria for only part of their life cycle. Some sections contain only one species.

The name Mycena comes from the Ancient Greek μύκης, meaning mushroom.[5] Species in the genus Mycena (and in Hemimycena) are commonly known as Bonnets.[6]

Selected species[edit]

See also[edit]

References[edit]

  1. ^ Gaston Guzman, John W. Allen & Jochen Gartz, "A Worldwide Geographical Distribution of the Neurotropic Fungi, An Analysis And Discussion",Vol14(1998), 189–280, 2000.[1]
  2. ^ Desjardin DE, Perry BA, Lodge DJ, Stevani CV, Nagasawa E. (2010). "Luminescent Mycena: new and noteworthy species". Mycologia 102 (2): 459–77. doi:10.3852/09-197. PMID 20361513. 
  3. ^ Desjardin DE, Oliveira AG, Stevani CV. (2008). "Fungi bioluminescence revisited". Photochemical & Photobiological sciences 7 (2): 170–82. doi:10.1039/b713328f. PMID 18264584. 
  4. ^ National Geographic Photo in the News article
  5. ^ Rea, Carleton (1922). British Basidiomycetaceae: a Handbook to the Larger British Fungi. Cambridge, UK: Cambridge University Press. p. 373. 
  6. ^ "Recommended English Names for Fungi in the UK" (PDF). British Mycological Society. 

Further reading[edit]

  • Smith, Alexander Hancett. North American Species of Mycena. Ann Arbor: Univ. of Michigan Press, 1947.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!