Overview

Brief Summary

Freyer’s Purple Emperor is a butterfly of very warm, damp places. The butterflies can be found along wooded riverbanks, with its foodplant, White Willow (Salix alba). The males and females meet each other at the tops of tall trees and the females lay their eggs in small batches at the top of the tree, on leaves in the crown. The caterpillars grow quickly and pupate suspended under a leaf or on a twig. The caterpillars from the generation that follows hibernate. The butterflies have a varied diet. The females visit flowers for nectar, aphids for honeydew and ripe fruit for the sugars. The males are often found on damp ground, on dung and on carrion. The butterflies are also attracted to sap oozing from wounded trees. This species has two generations a year. Habitats: mixed woodland (23%), alluvial and very wet forests and brush (23%), broad-leaved deciduous forests (17%), water-fringe vegetation (17%).

  • Levente A (2005) Biomonitoring along Drava in Hungary, 2000–2004. Natura Somogyensis 7: 63-73.
  • Slamka F (1989) Apatura ilia (Denis Et Schiffermuller, 1775) and Apatura ilia metis (Freyer, 1829) (Lepidoptera, Nymphalidae). Biologia 44: 601-604.
  • Weidemann HJ (1982a) Bemerkungen zu Lebensraum und Lebensweise des “Donauschillerfalters” Apatura metis und seiner Präimaginalstadien (Lep.: Nymphalidae), 2. Butterfly, ethology, geograhic distribution, population density, Europe. Entomologische Zeitschrift 92: 265-274.
  • Weidemann HJ (1982b) Bemerkungen zu Lebensraum und Lebensweise des “Donauschillerfalters” Apatura metis und seiner Praimaginalstadien (Lepidoptera: Nymphalidae), 4. Taxonomic morphology (concluded). Entomologische Zeitschrift 92: 297-309.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apatura metis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGATTATTTTCTACAAATCATAAAGATATTGGTACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTATATTAATTCGAACTGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATACTTGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTCTACCCCCCTCATTAGTTTTATTAATTTCTAGAAGAATTGTGGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATGGAGGTTCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAGTTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACTGCATTACTTTTACTATTATCTTTACCCGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATATTAATACCTCATTTTTTGATCCTGCGGGAGGAGGAGACCCAATTTTATATCAACACTTATTTTGATTTTTTGGCCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATTATTTCACAAGAAAGAGGCAAAAAAGAAACTTTTGGCAATTTAGGAATAATTTATGCTATAATAACAATTGGTCTATTGGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGTATAGATATTGATACACGAGCCTATTTTACTTCAGCTACCATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTAGCAACATTACATGGAACTCAAATTAATTATAGACCTTCAATATTATGAAGATTAGGTTTTATTTTCTTATTTACTGTAGGAGGATTAACAGGAGTAATTTTAGCTAATTCTTCTATTGATATTACTCTTCACGATACTTATTATGTAGTTGCTCACTTCCATTATGTATTATCAATAGGAGCTGTATTTGCTATTTTAGGAAGTTTTATTCATTGATACCCATTATTTACAGGCTTAACATTAAATAATTACTTATTAAAAATTCAATTTTTTTCTATATTTATTGGGGTTAATTTAACATTTTTTCCTCAACATTTCTTAGGATTAGCTGGGATACCTCGACGTTATTCTGATTACCCTGATAGATTCCTATCATGAAATATTATTTCATCTTTTGGGTCTTATATTTCTTTAATCTCAACTATAATAATAATTATTATTATTTGAGAGTCTATAATTAACCAACGAATTATTTTATTTTCATTAAATATACCTTCTTCAATTGAATGATATCAAAATTTACCTCCTGCAGAACATTCCTATAATGAATTACCTATTTTAAGTAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apatura metis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Apatura metis

The Freyer's Purple Emperor (Apatura metis) is a species of butterfly found in Eurasia.

Appearance[edit]

Freyer's purple emperor has dark wings with reddish and yellow bands. The wings of the male insect are bluish purple if the observer sees it from the right angle.

Systematics[edit]

Freyer's purple emperor belongs to the genus Apatura, subfamily Apaturinae. The species is divided into seven subspecies:

Apatura metis substituta
(Mount Kirigamine, Japan)


Habitat and ecology[edit]

Freyer's purple emperor usually inhabits forests and is often found nearby rivers and streams. The female spends the majority of her life in the foliage. The largest habitat of the animal is the Gemenc forest in Southern Hungary. Although it is one of the rarest animals in Europe, it can be seen in large quantities there. In Europe, Freyer's purple emperor usually has one, sometimes two generations, the first in May and June, the second in July and August. The caterpillars feed on willow species.

This species is stoutly protected in Europe. The nominal worth of a single specimen is 50,000 HUF, which equals about USD $238.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!